ID: 1117546582

View in Genome Browser
Species Human (GRCh38)
Location 14:56798370-56798392
Sequence GCCTGTACGCCCGCGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546582_1117546596 22 Left 1117546582 14:56798370-56798392 CCCACTCCCGCGGGCGTACAGGC No data
Right 1117546596 14:56798415-56798437 GCCGCGGCCCACAGCGCCCTGGG No data
1117546582_1117546598 27 Left 1117546582 14:56798370-56798392 CCCACTCCCGCGGGCGTACAGGC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546582_1117546588 -5 Left 1117546582 14:56798370-56798392 CCCACTCCCGCGGGCGTACAGGC No data
Right 1117546588 14:56798388-56798410 CAGGCCTCGCCACCGGGCCTCGG No data
1117546582_1117546595 21 Left 1117546582 14:56798370-56798392 CCCACTCCCGCGGGCGTACAGGC No data
Right 1117546595 14:56798414-56798436 TGCCGCGGCCCACAGCGCCCTGG No data
1117546582_1117546591 6 Left 1117546582 14:56798370-56798392 CCCACTCCCGCGGGCGTACAGGC No data
Right 1117546591 14:56798399-56798421 ACCGGGCCTCGGCCTTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546582 Original CRISPR GCCTGTACGCCCGCGGGAGT GGG (reversed) Intergenic