ID: 1117546584

View in Genome Browser
Species Human (GRCh38)
Location 14:56798376-56798398
Sequence GGCGAGGCCTGTACGCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546584_1117546595 15 Left 1117546584 14:56798376-56798398 CCCGCGGGCGTACAGGCCTCGCC No data
Right 1117546595 14:56798414-56798436 TGCCGCGGCCCACAGCGCCCTGG No data
1117546584_1117546596 16 Left 1117546584 14:56798376-56798398 CCCGCGGGCGTACAGGCCTCGCC No data
Right 1117546596 14:56798415-56798437 GCCGCGGCCCACAGCGCCCTGGG No data
1117546584_1117546598 21 Left 1117546584 14:56798376-56798398 CCCGCGGGCGTACAGGCCTCGCC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546584_1117546591 0 Left 1117546584 14:56798376-56798398 CCCGCGGGCGTACAGGCCTCGCC No data
Right 1117546591 14:56798399-56798421 ACCGGGCCTCGGCCTTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546584 Original CRISPR GGCGAGGCCTGTACGCCCGC GGG (reversed) Intergenic