ID: 1117546589

View in Genome Browser
Species Human (GRCh38)
Location 14:56798392-56798414
Sequence AAGGCCGAGGCCCGGTGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546589_1117546598 5 Left 1117546589 14:56798392-56798414 CCTCGCCACCGGGCCTCGGCCTT No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546589_1117546596 0 Left 1117546589 14:56798392-56798414 CCTCGCCACCGGGCCTCGGCCTT No data
Right 1117546596 14:56798415-56798437 GCCGCGGCCCACAGCGCCCTGGG No data
1117546589_1117546595 -1 Left 1117546589 14:56798392-56798414 CCTCGCCACCGGGCCTCGGCCTT No data
Right 1117546595 14:56798414-56798436 TGCCGCGGCCCACAGCGCCCTGG No data
1117546589_1117546602 16 Left 1117546589 14:56798392-56798414 CCTCGCCACCGGGCCTCGGCCTT No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546589 Original CRISPR AAGGCCGAGGCCCGGTGGCG AGG (reversed) Intergenic