ID: 1117546590

View in Genome Browser
Species Human (GRCh38)
Location 14:56798397-56798419
Sequence GCGGCAAGGCCGAGGCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546590_1117546596 -5 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546596 14:56798415-56798437 GCCGCGGCCCACAGCGCCCTGGG No data
1117546590_1117546595 -6 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546595 14:56798414-56798436 TGCCGCGGCCCACAGCGCCCTGG No data
1117546590_1117546602 11 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546590_1117546610 30 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546610 14:56798450-56798472 GAGGCCTGAGAACTACGCCCGGG No data
1117546590_1117546609 29 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546590_1117546598 0 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546590 Original CRISPR GCGGCAAGGCCGAGGCCCGG TGG (reversed) Intergenic