ID: 1117546592

View in Genome Browser
Species Human (GRCh38)
Location 14:56798400-56798422
Sequence GCCGCGGCAAGGCCGAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546592_1117546609 26 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546592_1117546612 29 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546592_1117546598 -3 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546592_1117546602 8 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546592_1117546610 27 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546610 14:56798450-56798472 GAGGCCTGAGAACTACGCCCGGG No data
1117546592_1117546595 -9 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546595 14:56798414-56798436 TGCCGCGGCCCACAGCGCCCTGG No data
1117546592_1117546613 30 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546613 14:56798453-56798475 GCCTGAGAACTACGCCCGGGGGG No data
1117546592_1117546596 -8 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546596 14:56798415-56798437 GCCGCGGCCCACAGCGCCCTGGG No data
1117546592_1117546611 28 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546611 14:56798451-56798473 AGGCCTGAGAACTACGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546592 Original CRISPR GCCGCGGCAAGGCCGAGGCC CGG (reversed) Intergenic