ID: 1117546593

View in Genome Browser
Species Human (GRCh38)
Location 14:56798405-56798427
Sequence TGTGGGCCGCGGCAAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546593_1117546610 22 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546610 14:56798450-56798472 GAGGCCTGAGAACTACGCCCGGG No data
1117546593_1117546612 24 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546593_1117546613 25 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546613 14:56798453-56798475 GCCTGAGAACTACGCCCGGGGGG No data
1117546593_1117546609 21 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546593_1117546602 3 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546593_1117546611 23 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546611 14:56798451-56798473 AGGCCTGAGAACTACGCCCGGGG No data
1117546593_1117546615 30 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546615 14:56798458-56798480 AGAACTACGCCCGGGGGGCGCGG No data
1117546593_1117546598 -8 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546593 Original CRISPR TGTGGGCCGCGGCAAGGCCG AGG (reversed) Intergenic