ID: 1117546598

View in Genome Browser
Species Human (GRCh38)
Location 14:56798420-56798442
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546584_1117546598 21 Left 1117546584 14:56798376-56798398 CCCGCGGGCGTACAGGCCTCGCC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546583_1117546598 26 Left 1117546583 14:56798371-56798393 CCACTCCCGCGGGCGTACAGGCC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546590_1117546598 0 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546593_1117546598 -8 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546585_1117546598 20 Left 1117546585 14:56798377-56798399 CCGCGGGCGTACAGGCCTCGCCA No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546582_1117546598 27 Left 1117546582 14:56798370-56798392 CCCACTCCCGCGGGCGTACAGGC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546589_1117546598 5 Left 1117546589 14:56798392-56798414 CCTCGCCACCGGGCCTCGGCCTT No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data
1117546592_1117546598 -3 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546598 Original CRISPR GGCCCACAGCGCCCTGGGAC CGG Intergenic