ID: 1117546602

View in Genome Browser
Species Human (GRCh38)
Location 14:56798431-56798453
Sequence CCCTGGGACCGGCGCCCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546593_1117546602 3 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546592_1117546602 8 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546597_1117546602 -8 Left 1117546597 14:56798416-56798438 CCGCGGCCCACAGCGCCCTGGGA No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546589_1117546602 16 Left 1117546589 14:56798392-56798414 CCTCGCCACCGGGCCTCGGCCTT No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546590_1117546602 11 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
1117546594_1117546602 -3 Left 1117546594 14:56798411-56798433 CCTTGCCGCGGCCCACAGCGCCC No data
Right 1117546602 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546602 Original CRISPR CCCTGGGACCGGCGCCCCCG AGG Intergenic