ID: 1117546609

View in Genome Browser
Species Human (GRCh38)
Location 14:56798449-56798471
Sequence CGAGGCCTGAGAACTACGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546590_1117546609 29 Left 1117546590 14:56798397-56798419 CCACCGGGCCTCGGCCTTGCCGC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546603_1117546609 -6 Left 1117546603 14:56798432-56798454 CCTGGGACCGGCGCCCCCGAGGC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546601_1117546609 -5 Left 1117546601 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546594_1117546609 15 Left 1117546594 14:56798411-56798433 CCTTGCCGCGGCCCACAGCGCCC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546600_1117546609 3 Left 1117546600 14:56798423-56798445 CCACAGCGCCCTGGGACCGGCGC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546592_1117546609 26 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546599_1117546609 4 Left 1117546599 14:56798422-56798444 CCCACAGCGCCCTGGGACCGGCG No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546593_1117546609 21 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data
1117546597_1117546609 10 Left 1117546597 14:56798416-56798438 CCGCGGCCCACAGCGCCCTGGGA No data
Right 1117546609 14:56798449-56798471 CGAGGCCTGAGAACTACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546609 Original CRISPR CGAGGCCTGAGAACTACGCC CGG Intergenic