ID: 1117546612

View in Genome Browser
Species Human (GRCh38)
Location 14:56798452-56798474
Sequence GGCCTGAGAACTACGCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546597_1117546612 13 Left 1117546597 14:56798416-56798438 CCGCGGCCCACAGCGCCCTGGGA No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546599_1117546612 7 Left 1117546599 14:56798422-56798444 CCCACAGCGCCCTGGGACCGGCG No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546592_1117546612 29 Left 1117546592 14:56798400-56798422 CCGGGCCTCGGCCTTGCCGCGGC No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546603_1117546612 -3 Left 1117546603 14:56798432-56798454 CCTGGGACCGGCGCCCCCGAGGC No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546594_1117546612 18 Left 1117546594 14:56798411-56798433 CCTTGCCGCGGCCCACAGCGCCC No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546600_1117546612 6 Left 1117546600 14:56798423-56798445 CCACAGCGCCCTGGGACCGGCGC No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546593_1117546612 24 Left 1117546593 14:56798405-56798427 CCTCGGCCTTGCCGCGGCCCACA No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546604_1117546612 -10 Left 1117546604 14:56798439-56798461 CCGGCGCCCCCGAGGCCTGAGAA No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data
1117546601_1117546612 -2 Left 1117546601 14:56798431-56798453 CCCTGGGACCGGCGCCCCCGAGG No data
Right 1117546612 14:56798452-56798474 GGCCTGAGAACTACGCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546612 Original CRISPR GGCCTGAGAACTACGCCCGG GGG Intergenic