ID: 1117546933

View in Genome Browser
Species Human (GRCh38)
Location 14:56801064-56801086
Sequence CTTGAACTCCACCTCTGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117546933_1117546937 -5 Left 1117546933 14:56801064-56801086 CCCCTGCAGAGGTGGAGTTCAAG 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1117546937 14:56801082-56801104 TCAAGGTTGCATACAATAACAGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117546933 Original CRISPR CTTGAACTCCACCTCTGCAG GGG (reversed) Exonic
904269042 1:29337095-29337117 ATTGAAAGCCTCCTCTGCAGTGG - Intergenic
908378193 1:63567560-63567582 CTTAAGTGCCACCTCTGCAGAGG - Intronic
910370734 1:86512876-86512898 ATTAAAATCCTCCTCTGCAGAGG - Intergenic
910393395 1:86767602-86767624 CTTAAACTCCACCTCTTCAATGG - Intergenic
910948314 1:92617455-92617477 ATTAAACTCCTCCTCTGCTGAGG - Intronic
911738292 1:101361177-101361199 ATTAAACTCCTCCTCTGCTGAGG + Intergenic
917796979 1:178539602-178539624 CTTGTCCCCCACCCCTGCAGAGG - Intronic
919726746 1:200889471-200889493 CTTGAACTCCAGCTCTTCCCTGG + Intergenic
920296224 1:204958815-204958837 ATTGTTCACCACCTCTGCAGGGG - Intronic
920975236 1:210779840-210779862 CTGAACCTCCACTTCTGCAGTGG + Intronic
923197353 1:231681511-231681533 CTTGAACTCCACCTCCCTGGTGG + Intronic
924611751 1:245579411-245579433 CTTGAACTCCTGGGCTGCAGTGG - Intronic
1063102061 10:2958909-2958931 CCTGAACTCGACCCCTGTAGGGG - Intergenic
1063459126 10:6204164-6204186 CTCGAGCTCCACCTCAGCTGCGG + Intronic
1065453593 10:25883469-25883491 ATTTAACTCCTCCTCTGCTGAGG - Intergenic
1065565300 10:27001957-27001979 CTTGACCTCCAACCCTGTAGAGG - Intronic
1065747553 10:28856110-28856132 CTTGAACTCTACCACTGGAAAGG - Intronic
1065873237 10:29974148-29974170 GTTCAACTCCACATGTGCAGAGG + Intergenic
1066066035 10:31761546-31761568 CTTGAACTCCAGGCCTCCAGTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1068579005 10:58717828-58717850 CTTGAACTCCTACTAGGCAGGGG + Intronic
1071237095 10:83661745-83661767 CTAGAACCTCACCTCTGCTGCGG + Intergenic
1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG + Intergenic
1073889361 10:108081293-108081315 CTGGAACTCCACCTCCCCAAGGG + Intergenic
1075668449 10:124246991-124247013 CATGCACTCCTCCACTGCAGGGG + Intergenic
1076276724 10:129205785-129205807 CTGAAACTGCTCCTCTGCAGAGG + Intergenic
1076426374 10:130370215-130370237 CCTCCTCTCCACCTCTGCAGGGG - Intergenic
1077219109 11:1407545-1407567 CTCAGACCCCACCTCTGCAGGGG + Intronic
1077240047 11:1505927-1505949 CTGGAATACCACCTCTGTAGCGG + Intergenic
1077308996 11:1880281-1880303 CTTGACCTCCCCCTCTGCCCAGG - Intronic
1089104089 11:115987611-115987633 CTTGAACTCCACCTGTTTATTGG - Intergenic
1089265283 11:117255085-117255107 CTTGAACTCCTCTTCCTCAGAGG + Intronic
1089513887 11:119019123-119019145 CGTTAGCTTCACCTCTGCAGTGG + Exonic
1089644148 11:119866917-119866939 CTTCATCTTCACCTCTTCAGTGG + Intergenic
1091242513 11:134063411-134063433 CTTGAATCCCACATCTGCAAAGG - Intergenic
1092222356 12:6723757-6723779 CCTGATCTCCAGCTCTCCAGCGG + Exonic
1094389696 12:29935502-29935524 ATTAAACTCCTCCTCTGCTGAGG + Intergenic
1097572215 12:61347953-61347975 CTTGAACTCGACCTGAGAAGTGG + Intergenic
1097606190 12:61757463-61757485 CTTGATTTCCATCTCTGCATTGG - Intronic
1098158467 12:67624296-67624318 CTTAAAGTCCTCCTCTGCTGAGG - Intergenic
1101440764 12:104702893-104702915 CTTGGACTCCAAGTCTGCAAAGG - Intronic
1102782050 12:115573676-115573698 GTTGACCTCCAACTCTCCAGCGG - Intergenic
1104479902 12:129098724-129098746 ATTAGACTCCACCTCTCCAGTGG - Intronic
1104983259 12:132583192-132583214 CTTGACCTTCACGTCTCCAGGGG - Exonic
1105273049 13:18895435-18895457 CTTGAACTCGCCCTTTCCAGTGG + Intergenic
1106518358 13:30474668-30474690 CTTGAACTCCTCTTCTGCCTCGG - Intronic
1107864765 13:44693070-44693092 TTTGAATTCCAGCTCTTCAGCGG - Intergenic
1110955586 13:81549010-81549032 CCTGAAGTCTATCTCTGCAGTGG + Intergenic
1113772030 13:112916585-112916607 GTTGAGCTCCACCCCTGCACTGG + Intronic
1117209246 14:53478428-53478450 GTTCAAATCCATCTCTGCAGAGG + Intergenic
1117524205 14:56580603-56580625 CTAAAACACCACCTCTTCAGAGG - Intronic
1117546933 14:56801064-56801086 CTTGAACTCCACCTCTGCAGGGG - Exonic
1118437074 14:65781488-65781510 CTTGAACTACTCCTCTGAGGTGG + Intergenic
1118947371 14:70399657-70399679 CATGAATTCCCCCTCTGAAGAGG + Intronic
1119107464 14:71938120-71938142 ATTAAACTCCTCCTCTGCTGAGG + Intronic
1122299940 14:100725786-100725808 CTCTACCTCCACCTCTCCAGCGG + Intronic
1129200802 15:73998011-73998033 CTGGAACTCCTCCTCCGAAGCGG - Exonic
1129602609 15:77009159-77009181 GTTGGACTCCACACCTGCAGGGG - Intronic
1130835318 15:87644549-87644571 CTGGAACACCACCACTTCAGAGG + Intergenic
1130906115 15:88241849-88241871 CTGGAAATCGACCTCTGGAGAGG - Intronic
1131686014 15:94768416-94768438 CCTGAACTCCCCCCCTGCACGGG - Intergenic
1132002268 15:98192316-98192338 CTTGAACTCTTCCTAGGCAGCGG - Intergenic
1132646538 16:1001858-1001880 CTTGAACTTCACCTCCACGGTGG - Intergenic
1136185425 16:28585699-28585721 CTTGCACTCAGCCTCTGCATCGG - Exonic
1136272489 16:29156721-29156743 TGTCACCTCCACCTCTGCAGAGG + Intergenic
1137270843 16:46901441-46901463 CTGGAACTCCATCACCGCAGGGG - Intronic
1138392303 16:56678973-56678995 TTTTGACTCCGCCTCTGCAGGGG + Intronic
1138914251 16:61443633-61443655 ATTGTGCTCCACCTCTCCAGTGG - Intergenic
1139853337 16:69963287-69963309 CTAGAGCTACAGCTCTGCAGGGG + Intronic
1139882306 16:70186196-70186218 CTAGAGCTACAGCTCTGCAGGGG + Intronic
1140370203 16:74409308-74409330 CTAGAGCTACAGCTCTGCAGGGG - Intronic
1141535030 16:84673229-84673251 CTTGGAGTCAGCCTCTGCAGGGG + Intergenic
1141895587 16:86956854-86956876 TTAGAACTCCATCTCTGGAGAGG + Intergenic
1142223005 16:88864561-88864583 CGTGACCCCCCCCTCTGCAGGGG - Intronic
1142223017 16:88864591-88864613 CGTGACCCCCCCCTCTGCAGGGG - Intronic
1142961359 17:3554276-3554298 CTTGAACTCCACCTTTGGAATGG - Intronic
1145827107 17:27885251-27885273 CTTTCACGCCACTTCTGCAGAGG - Intronic
1146125178 17:30225709-30225731 CGTGGACCCCACCTCTGCTGTGG + Intronic
1147910654 17:43853982-43854004 GCTGGACTCCACCTCAGCAGAGG + Exonic
1148925223 17:51078316-51078338 CTTGAACTCCAGATTTCCAGTGG + Intronic
1150002508 17:61450887-61450909 CCTGAAATCCACCTCAACAGTGG - Intergenic
1150151023 17:62808710-62808732 CTGGAGTTCGACCTCTGCAGAGG + Intergenic
1150279250 17:63919323-63919345 CCTGAATTCCACTTCTGCTGAGG + Intergenic
1153555292 18:6306594-6306616 GTTGAACTCAACTTTTGCAGAGG - Intronic
1154024607 18:10695740-10695762 CTTTACCTCCACCTCTGCTAAGG + Intronic
1155670012 18:28358701-28358723 CTTGAAATCCATCCCTGCAATGG + Intergenic
1159861116 18:73650862-73650884 CTTGGACTCCACCACAGCAGTGG - Intergenic
1161590972 19:5128960-5128982 CCTGACCTCCACCCCGGCAGGGG - Intronic
1162572357 19:11480723-11480745 CTTCATCGCCACATCTGCAGCGG - Exonic
1163844542 19:19630810-19630832 ATTGAACTCCTCCTATGCACAGG + Intronic
1165091329 19:33389736-33389758 CTTGAGGTCCACCACTGAAGTGG + Intronic
1165971954 19:39639139-39639161 CTTGAACTCCTGTGCTGCAGGGG - Intergenic
1166239210 19:41478392-41478414 CCTGAAATCCACCTCCCCAGCGG - Intergenic
1166241856 19:41499904-41499926 CCTGAAATCCACCTCCCCAGCGG - Intergenic
1167717771 19:51154919-51154941 CTTGAATCCCACCTCTTCTGTGG + Intergenic
1168369350 19:55819203-55819225 ATTCTACCCCACCTCTGCAGGGG + Intronic
925375381 2:3380085-3380107 CTTGCTCTCCACGTCTGCAGAGG + Intronic
925422571 2:3724836-3724858 CTTGAACCTCACCTCTGCCAGGG - Intronic
925965987 2:9066711-9066733 CTTGCACTTCCCATCTGCAGGGG + Intergenic
926751687 2:16203271-16203293 CTTGAACTGCAACTCTTCTGTGG + Intergenic
927948952 2:27154649-27154671 CTTGAACCACGTCTCTGCAGAGG + Exonic
930697129 2:54423274-54423296 TTGGAACTCCAGCTCTGCAGAGG + Intergenic
932553006 2:72791322-72791344 CTTGAACTCCACAGCTCAAGTGG - Intronic
936530188 2:113271024-113271046 CTAAAACTGAACCTCTGCAGAGG + Intronic
937042999 2:118835637-118835659 CTCGGACTCGGCCTCTGCAGCGG - Intergenic
937151918 2:119691974-119691996 TCTGGACTCCACCCCTGCAGAGG + Intergenic
939573957 2:143873930-143873952 CTTGAAGTCAACTGCTGCAGTGG - Intergenic
941553331 2:166943580-166943602 ATTCCACTCCACCTCTGCAGAGG + Intronic
942066603 2:172277460-172277482 CTTGAGCACCACCTCTTGAGAGG - Intergenic
942305339 2:174601599-174601621 TTTGGAAGCCACCTCTGCAGTGG + Intronic
942964647 2:181876845-181876867 CTTGACCTCCTCTTCTACAGAGG + Intergenic
943781716 2:191831216-191831238 CTTAAAATCCACCTGTGCAGAGG - Intergenic
947916383 2:233834536-233834558 CTTGAACACCACTGATGCAGTGG + Intronic
948025260 2:234771395-234771417 CTTAAATGTCACCTCTGCAGGGG - Intergenic
948682995 2:239648963-239648985 CTGGAACTCCACCTGTGCTGGGG + Intergenic
948921294 2:241067128-241067150 CTGGAGCCCCAACTCTGCAGCGG - Intronic
1169801904 20:9519052-9519074 CTTGTGCCCTACCTCTGCAGGGG - Intronic
1171848795 20:30293555-30293577 TTTGACCACCACCTCTGCTGTGG - Intergenic
1172030375 20:31977830-31977852 TGTGAACTCCACATCAGCAGAGG + Intronic
1173457984 20:43219068-43219090 ATTGAGCTCCACCTCTCAAGGGG - Intergenic
1173620131 20:44430191-44430213 CTCCAACACCACCTCTCCAGAGG + Exonic
1174488266 20:50874694-50874716 CTTGATCTCCCCCTCTGCACTGG + Intronic
1174806225 20:53606646-53606668 CTTGGATTCCAACTCTGCTGGGG - Intronic
1177147646 21:17423652-17423674 CTTGAACTCCACACCTCAAGTGG + Intergenic
1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG + Intronic
1178758135 21:35372648-35372670 CCTGAGCTCATCCTCTGCAGAGG + Intronic
1181915923 22:26279780-26279802 CTTGTATTCTACCTCTCCAGGGG - Intronic
1182119729 22:27779005-27779027 CTTCACCCCCATCTCTGCAGGGG - Intronic
1184944978 22:47796435-47796457 CTTGGACTCCAGCACTGCTGAGG + Intergenic
950304524 3:11907814-11907836 CTGGGACTCCACCACTGCTGCGG - Intergenic
950612996 3:14138128-14138150 CTTGAACCCCATTTCTTCAGAGG - Intronic
951052341 3:18108294-18108316 TTTCAACTTCACCTCTTCAGTGG + Intronic
956058981 3:65330795-65330817 CATGAACTCCACTTCAGCACTGG - Intergenic
957744230 3:84317868-84317890 GTTAAAATCCACCTCTGTAGAGG + Intergenic
961262941 3:125617105-125617127 ATTAAACTCCTCCTCTGCTGAGG - Intergenic
961377809 3:126478419-126478441 CTTGTACTCCACCTCTCAATGGG + Intergenic
961383706 3:126512247-126512269 CTGAAACTCCTCCTCTGCTGAGG - Intronic
962604712 3:137023795-137023817 GCTGCTCTCCACCTCTGCAGGGG + Intergenic
965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG + Intergenic
965515037 3:169612294-169612316 CTTGAACTTCACATCTAAAGGGG - Intronic
967121379 3:186385540-186385562 CATGAAGTCCACCTCAGCATTGG - Intergenic
968311068 3:197683405-197683427 CCTGCACTCCACGTCTGCTGAGG - Exonic
968649498 4:1754868-1754890 CTTGAACTCCAAATCTGCCCTGG + Intergenic
968669512 4:1841491-1841513 CTTCACCACCACCTCTGCGGGGG + Exonic
968980538 4:3846741-3846763 CATGAAGCCCACCCCTGCAGTGG - Intergenic
969322966 4:6424158-6424180 CTGGAGCTCCAGCTCTGGAGAGG + Intronic
970524453 4:16917256-16917278 CTTAAACACCACCTCTTCATCGG + Intergenic
973879846 4:55258970-55258992 CTTGAACTCCCACTGTGCACAGG + Intergenic
976245479 4:83002317-83002339 CTTGAACTCCACCTGGGCTTAGG - Intronic
979156332 4:117394616-117394638 CTTGAAATGCAGATCTGCAGTGG - Intergenic
982835640 4:160117361-160117383 ATTAAACTCCCCCTCTGCTGAGG - Intergenic
983582776 4:169325531-169325553 ATTAAACTCCTCCTCTGCTGAGG - Intergenic
984192308 4:176620253-176620275 CTTGAGCTCCTCCTCCCCAGGGG + Intergenic
986008820 5:3693313-3693335 GTGGAGCTCCACCTCTGCTGTGG - Intergenic
986177519 5:5364776-5364798 CTTGAACTCCAGCGCTGAAGAGG + Intergenic
986738884 5:10688773-10688795 GTTCCACTCCACCTCTGCAAAGG - Intronic
988079731 5:26400710-26400732 ATTAAACTCCTCCTCTGCTGAGG + Intergenic
992904971 5:81337105-81337127 CTTCAACTCCCCCTGTGCTGGGG - Intronic
998528597 5:142864667-142864689 CTTCCACTCCACCTCTGCTGTGG + Intronic
999529270 5:152444414-152444436 CTAGAGAACCACCTCTGCAGGGG + Intergenic
999765886 5:154740600-154740622 GTGGAATTCCAGCTCTGCAGCGG - Intronic
1000831189 5:166103009-166103031 GGTGGACTCCACCTCTGCAGAGG + Intergenic
1001692874 5:173645904-173645926 CTTGAATTTCACCTCTGAAGAGG + Intergenic
1002283277 5:178145920-178145942 CTGGACCTCCACCTCCCCAGTGG + Intronic
1003716426 6:8651692-8651714 ATTGAACTCCAGTTCTGCATGGG + Intergenic
1003791324 6:9550765-9550787 ATTAAACTCCTCCTCTGCTGAGG - Intergenic
1007125120 6:39419412-39419434 CCTTAACTTCACCTTTGCAGGGG + Intronic
1008748578 6:54703942-54703964 CTTGAATGCCACCTCTTCTGTGG - Intergenic
1009764836 6:68058644-68058666 CTTGAACTCATGCTCAGCAGTGG + Intergenic
1013091136 6:106901826-106901848 TGAGAGCTCCACCTCTGCAGTGG - Intergenic
1014134798 6:117876273-117876295 ATTAAGCTCCACCTCTGGAGGGG + Intergenic
1014337797 6:120159750-120159772 CTGGCACCCCACCTCTGCACAGG + Intergenic
1014534092 6:122595885-122595907 ATTAAACTCCTCCTCTGCTGAGG + Intronic
1015302522 6:131669996-131670018 CTTGTACTTCACTGCTGCAGAGG + Intronic
1015475844 6:133658200-133658222 ATTGAAATCCTCCTCTGCTGAGG - Intergenic
1016553563 6:145309805-145309827 CTTGAACTTCATCTGTACAGAGG + Intergenic
1019434575 7:1015416-1015438 CATGAACCCAGCCTCTGCAGGGG - Intronic
1019444440 7:1063975-1063997 CCTGCCCCCCACCTCTGCAGAGG - Intronic
1020111009 7:5447809-5447831 CTTCAACCCCAGCTCTGCTGGGG + Intronic
1024230672 7:47361059-47361081 ATTGGCCTCCAACTCTGCAGAGG - Intronic
1024356027 7:48414204-48414226 CATGAACGGCGCCTCTGCAGCGG + Intronic
1027167162 7:75843017-75843039 GTTGATCTCCACTTCTGCGGGGG - Intronic
1028237921 7:88383539-88383561 ATTAAACTCCTCCTCTGCTGAGG - Intergenic
1028832140 7:95339943-95339965 CTTTAAGGCCACCTCTGAAGTGG - Intergenic
1030931189 7:115524964-115524986 ATTAAACTCCTCCTCTGCTGAGG + Intergenic
1034457487 7:151178916-151178938 GTTGATCCCCACCTCTGCACTGG + Intronic
1034477456 7:151294121-151294143 ATTGAAAGCCTCCTCTGCAGTGG + Intergenic
1035289674 7:157829901-157829923 CCTGCCCTGCACCTCTGCAGTGG + Intronic
1035854823 8:2963436-2963458 TTTGAACATCACCGCTGCAGCGG - Intronic
1037081060 8:14787173-14787195 CTTAAAATCCCCATCTGCAGGGG + Intronic
1039231051 8:35448567-35448589 CCTGAGCCCCACCTCTGCTGGGG - Intronic
1042791715 8:72615066-72615088 CTTGGACTCCACGTTTGCAGTGG + Intronic
1043647650 8:82541237-82541259 CTTGAACATCCCCTTTGCAGTGG + Intergenic
1045280933 8:100749254-100749276 CTTGAACCTCCTCTCTGCAGAGG - Intergenic
1046916516 8:119683441-119683463 CTAGAACTGCACCTCTGCAAGGG - Intergenic
1049418888 8:142508110-142508132 CTTGAACTGCAGGTCTGCAAGGG + Intronic
1049558419 8:143295411-143295433 CTTGAACTCCAAGTCTCAAGTGG + Intronic
1052238294 9:26240108-26240130 TTTTAATTCCACCTCTGCATTGG + Intergenic
1052737246 9:32354860-32354882 ATTAAACTCCTCCTCTGCTGAGG + Intergenic
1053786510 9:41656323-41656345 TTTGACCACCACCTCTGCTGTGG - Intergenic
1054158556 9:61657900-61657922 TTTGACCACCACCTCTGCTGTGG + Intergenic
1054175228 9:61870289-61870311 TTTGACCACCACCTCTGCTGTGG - Intergenic
1054478330 9:65588905-65588927 TTTGACCACCACCTCTGCTGTGG + Intergenic
1054662309 9:67710507-67710529 TTTGACCACCACCTCTGCTGTGG + Intergenic
1055903842 9:81270474-81270496 ATTAAAATCCTCCTCTGCAGAGG + Intergenic
1056314140 9:85372228-85372250 ATTGAAATCCTCCTCTGCAGAGG + Intergenic
1056317274 9:85401952-85401974 CTTGAACTCCAACTAGGCATTGG + Intergenic
1056496156 9:87157492-87157514 CTTGAAGACTACCTCTGCACGGG - Exonic
1059323066 9:113484015-113484037 CTTCAAGTCAGCCTCTGCAGAGG - Intronic
1060249734 9:121976174-121976196 GGAGAACTCCACCTGTGCAGGGG - Intronic
1060933094 9:127501088-127501110 CTGCACCTCCAGCTCTGCAGGGG - Exonic
1061819570 9:133218840-133218862 CTGGAGCTCTTCCTCTGCAGAGG - Intergenic
1062728969 9:138097824-138097846 CTTAAACTGCAGCTCAGCAGAGG + Intronic
1185668693 X:1788402-1788424 TTTCAGTTCCACCTCTGCAGAGG - Intergenic
1186880215 X:13857764-13857786 CTTGAGCACCAACTGTGCAGTGG + Intronic
1189154787 X:38746016-38746038 ATTAAACTCCTCCTCTGCTGAGG + Intergenic
1190429652 X:50367059-50367081 CCTGTGCTCCACCTCCGCAGGGG - Exonic
1190725376 X:53186986-53187008 ATTGAGCTCCTCTTCTGCAGTGG - Intergenic
1191095616 X:56670456-56670478 ATTGAAATCCTCCTCTGCTGAGG + Intergenic
1191933003 X:66394881-66394903 ATTAAACTCCTCCTCTGCTGAGG - Intergenic
1194995250 X:100584947-100584969 TTGCAACTCCACCTCAGCAGTGG + Exonic
1195178052 X:102329592-102329614 CTTGAACTGCAGCTCTTCATTGG + Intergenic
1195180812 X:102357501-102357523 CTTGAACTGCAGCTCTTCATTGG - Intergenic