ID: 1117549094

View in Genome Browser
Species Human (GRCh38)
Location 14:56816753-56816775
Sequence CTCGAGCTGCGCCGCCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117549090_1117549094 -1 Left 1117549090 14:56816731-56816753 CCCTGCCGGCGGGTCGCCGGGTC No data
Right 1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG No data
1117549089_1117549094 0 Left 1117549089 14:56816730-56816752 CCCCTGCCGGCGGGTCGCCGGGT No data
Right 1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG No data
1117549091_1117549094 -2 Left 1117549091 14:56816732-56816754 CCTGCCGGCGGGTCGCCGGGTCT No data
Right 1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG No data
1117549092_1117549094 -6 Left 1117549092 14:56816736-56816758 CCGGCGGGTCGCCGGGTCTCGAG No data
Right 1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117549094 Original CRISPR CTCGAGCTGCGCCGCCCCGC TGG Intergenic
No off target data available for this crispr