ID: 1117549573

View in Genome Browser
Species Human (GRCh38)
Location 14:56820618-56820640
Sequence CAAATTATTCAGAAGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117549569_1117549573 20 Left 1117549569 14:56820575-56820597 CCTGTGGTCTGTAGAGAAGCCAT No data
Right 1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG No data
1117549570_1117549573 1 Left 1117549570 14:56820594-56820616 CCATATTGATTAATACTTTTCAT No data
Right 1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117549573 Original CRISPR CAAATTATTCAGAAGGTTGA GGG Intergenic
No off target data available for this crispr