ID: 1117551196

View in Genome Browser
Species Human (GRCh38)
Location 14:56838276-56838298
Sequence CATAGTTACCATTGTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117551196_1117551201 12 Left 1117551196 14:56838276-56838298 CCCACCACACAATGGTAACTATG No data
Right 1117551201 14:56838311-56838333 CGTGTCAACTAATTTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117551196 Original CRISPR CATAGTTACCATTGTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr