ID: 1117551961

View in Genome Browser
Species Human (GRCh38)
Location 14:56845571-56845593
Sequence CAGGCCCAGAATTCTATCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117551955_1117551961 29 Left 1117551955 14:56845519-56845541 CCATCTTTCAGCTAATGAAACTG No data
Right 1117551961 14:56845571-56845593 CAGGCCCAGAATTCTATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117551961 Original CRISPR CAGGCCCAGAATTCTATCGT TGG Intergenic
No off target data available for this crispr