ID: 1117553131

View in Genome Browser
Species Human (GRCh38)
Location 14:56856261-56856283
Sequence GGGTGCTTTCTCGGGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117553131_1117553142 6 Left 1117553131 14:56856261-56856283 CCCCAGCCCCCGAGAAAGCACCC No data
Right 1117553142 14:56856290-56856312 AGCAATAGGAGTCGGCCAGAAGG No data
1117553131_1117553141 -2 Left 1117553131 14:56856261-56856283 CCCCAGCCCCCGAGAAAGCACCC No data
Right 1117553141 14:56856282-56856304 CCTCAGAAAGCAATAGGAGTCGG No data
1117553131_1117553138 -8 Left 1117553131 14:56856261-56856283 CCCCAGCCCCCGAGAAAGCACCC No data
Right 1117553138 14:56856276-56856298 AAGCACCCTCAGAAAGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117553131 Original CRISPR GGGTGCTTTCTCGGGGGCTG GGG (reversed) Intergenic
No off target data available for this crispr