ID: 1117556544

View in Genome Browser
Species Human (GRCh38)
Location 14:56891847-56891869
Sequence TCCCAAGAAGTCCCCTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117556544_1117556549 14 Left 1117556544 14:56891847-56891869 CCAGTCCAGGGGACTTCTTGGGA No data
Right 1117556549 14:56891884-56891906 CACAGAAAGAAAATATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117556544 Original CRISPR TCCCAAGAAGTCCCCTGGAC TGG (reversed) Intergenic
No off target data available for this crispr