ID: 1117559562

View in Genome Browser
Species Human (GRCh38)
Location 14:56922995-56923017
Sequence ACTAGGCATTGCTGTAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117559562_1117559571 -6 Left 1117559562 14:56922995-56923017 CCCCCACTACAGCAATGCCTAGT No data
Right 1117559571 14:56923012-56923034 CCTAGTGGAGCTGCTGGGGCAGG No data
1117559562_1117559569 -10 Left 1117559562 14:56922995-56923017 CCCCCACTACAGCAATGCCTAGT No data
Right 1117559569 14:56923008-56923030 AATGCCTAGTGGAGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117559562 Original CRISPR ACTAGGCATTGCTGTAGTGG GGG (reversed) Intergenic
No off target data available for this crispr