ID: 1117561671

View in Genome Browser
Species Human (GRCh38)
Location 14:56946657-56946679
Sequence GAGCAGACCAGTAATTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117561666_1117561671 20 Left 1117561666 14:56946614-56946636 CCTCCTGACTACAGCAATAGAAT No data
Right 1117561671 14:56946657-56946679 GAGCAGACCAGTAATTATAAGGG No data
1117561665_1117561671 24 Left 1117561665 14:56946610-56946632 CCATCCTCCTGACTACAGCAATA No data
Right 1117561671 14:56946657-56946679 GAGCAGACCAGTAATTATAAGGG No data
1117561667_1117561671 17 Left 1117561667 14:56946617-56946639 CCTGACTACAGCAATAGAATCAA No data
Right 1117561671 14:56946657-56946679 GAGCAGACCAGTAATTATAAGGG No data
1117561664_1117561671 25 Left 1117561664 14:56946609-56946631 CCCATCCTCCTGACTACAGCAAT No data
Right 1117561671 14:56946657-56946679 GAGCAGACCAGTAATTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117561671 Original CRISPR GAGCAGACCAGTAATTATAA GGG Intergenic
No off target data available for this crispr