ID: 1117564563

View in Genome Browser
Species Human (GRCh38)
Location 14:56979671-56979693
Sequence TTTTTATTTTTGTTTTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117564563_1117564566 19 Left 1117564563 14:56979671-56979693 CCACTGGAAAACAAAAATAAAAA No data
Right 1117564566 14:56979713-56979735 CAGTATCTCCTCAAACAGCAGGG No data
1117564563_1117564565 18 Left 1117564563 14:56979671-56979693 CCACTGGAAAACAAAAATAAAAA No data
Right 1117564565 14:56979712-56979734 GCAGTATCTCCTCAAACAGCAGG No data
1117564563_1117564564 -4 Left 1117564563 14:56979671-56979693 CCACTGGAAAACAAAAATAAAAA No data
Right 1117564564 14:56979690-56979712 AAAACAAAAACAACAAAAAAAGG 0: 10
1: 94
2: 659
3: 25981
4: 37231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117564563 Original CRISPR TTTTTATTTTTGTTTTCCAG TGG (reversed) Intergenic
No off target data available for this crispr