ID: 1117564566

View in Genome Browser
Species Human (GRCh38)
Location 14:56979713-56979735
Sequence CAGTATCTCCTCAAACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117564563_1117564566 19 Left 1117564563 14:56979671-56979693 CCACTGGAAAACAAAAATAAAAA No data
Right 1117564566 14:56979713-56979735 CAGTATCTCCTCAAACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117564566 Original CRISPR CAGTATCTCCTCAAACAGCA GGG Intergenic
No off target data available for this crispr