ID: 1117566478

View in Genome Browser
Species Human (GRCh38)
Location 14:56999095-56999117
Sequence GAACAAGCTTTGGCAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117566474_1117566478 19 Left 1117566474 14:56999053-56999075 CCCACATGGCTGTTAAGATAAGC No data
Right 1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG No data
1117566473_1117566478 29 Left 1117566473 14:56999043-56999065 CCACTGAGGACCCACATGGCTGT No data
Right 1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG No data
1117566476_1117566478 -3 Left 1117566476 14:56999075-56999097 CCACTCATTATTATTTTCTAGAA No data
Right 1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG No data
1117566475_1117566478 18 Left 1117566475 14:56999054-56999076 CCACATGGCTGTTAAGATAAGCC No data
Right 1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117566478 Original CRISPR GAACAAGCTTTGGCAAAAAC TGG Intergenic
No off target data available for this crispr