ID: 1117573619

View in Genome Browser
Species Human (GRCh38)
Location 14:57074694-57074716
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117573619_1117573624 -1 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573624 14:57074716-57074738 TGTCCTTCCTTAAAGGGCCTGGG No data
1117573619_1117573622 -7 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573622 14:57074710-57074732 TGCAAATGTCCTTCCTTAAAGGG No data
1117573619_1117573628 7 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573628 14:57074724-57074746 CTTAAAGGGCCTGGGGAAGATGG No data
1117573619_1117573623 -2 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573623 14:57074715-57074737 ATGTCCTTCCTTAAAGGGCCTGG No data
1117573619_1117573625 0 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573625 14:57074717-57074739 GTCCTTCCTTAAAGGGCCTGGGG No data
1117573619_1117573621 -8 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573621 14:57074709-57074731 TTGCAAATGTCCTTCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117573619 Original CRISPR ATTTGCAAAGCAGAATGAAT GGG (reversed) Intergenic
No off target data available for this crispr