ID: 1117573623

View in Genome Browser
Species Human (GRCh38)
Location 14:57074715-57074737
Sequence ATGTCCTTCCTTAAAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117573619_1117573623 -2 Left 1117573619 14:57074694-57074716 CCCATTCATTCTGCTTTGCAAAT No data
Right 1117573623 14:57074715-57074737 ATGTCCTTCCTTAAAGGGCCTGG No data
1117573620_1117573623 -3 Left 1117573620 14:57074695-57074717 CCATTCATTCTGCTTTGCAAATG No data
Right 1117573623 14:57074715-57074737 ATGTCCTTCCTTAAAGGGCCTGG No data
1117573618_1117573623 -1 Left 1117573618 14:57074693-57074715 CCCCATTCATTCTGCTTTGCAAA No data
Right 1117573623 14:57074715-57074737 ATGTCCTTCCTTAAAGGGCCTGG No data
1117573617_1117573623 17 Left 1117573617 14:57074675-57074697 CCTTCGACTATATGTGAGCCCCA No data
Right 1117573623 14:57074715-57074737 ATGTCCTTCCTTAAAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117573623 Original CRISPR ATGTCCTTCCTTAAAGGGCC TGG Intergenic
No off target data available for this crispr