ID: 1117575034

View in Genome Browser
Species Human (GRCh38)
Location 14:57089020-57089042
Sequence TCTAGGGAACACACTTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117575029_1117575034 7 Left 1117575029 14:57088990-57089012 CCAAAAGATTGGGGACCTCTGGT No data
Right 1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG No data
1117575025_1117575034 16 Left 1117575025 14:57088981-57089003 CCCTGGTGTCCAAAAGATTGGGG No data
Right 1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG No data
1117575022_1117575034 21 Left 1117575022 14:57088976-57088998 CCGGTCCCTGGTGTCCAAAAGAT No data
Right 1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG No data
1117575021_1117575034 29 Left 1117575021 14:57088968-57088990 CCATGAAACCGGTCCCTGGTGTC 0: 7
1: 127
2: 770
3: 1326
4: 1617
Right 1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG No data
1117575032_1117575034 -8 Left 1117575032 14:57089005-57089027 CCTCTGGTTAGAGACTCTAGGGA No data
Right 1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG No data
1117575027_1117575034 15 Left 1117575027 14:57088982-57089004 CCTGGTGTCCAAAAGATTGGGGA No data
Right 1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117575034 Original CRISPR TCTAGGGAACACACTTAGGT TGG Intergenic
No off target data available for this crispr