ID: 1117575516

View in Genome Browser
Species Human (GRCh38)
Location 14:57093271-57093293
Sequence CACAAGGAGGATCCAGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117575509_1117575516 26 Left 1117575509 14:57093222-57093244 CCATAAAAAAGTAGAAAGCAGGC No data
Right 1117575516 14:57093271-57093293 CACAAGGAGGATCCAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117575516 Original CRISPR CACAAGGAGGATCCAGCAAA GGG Intergenic
No off target data available for this crispr