ID: 1117583042

View in Genome Browser
Species Human (GRCh38)
Location 14:57172140-57172162
Sequence CCGATCTTGCAGATCTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117583042_1117583047 30 Left 1117583042 14:57172140-57172162 CCATCCAAGATCTGCAAGATCGG No data
Right 1117583047 14:57172193-57172215 TGATGTGCCACAAAGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117583042 Original CRISPR CCGATCTTGCAGATCTTGGA TGG (reversed) Intergenic
No off target data available for this crispr