ID: 1117586947

View in Genome Browser
Species Human (GRCh38)
Location 14:57217621-57217643
Sequence CTGTGTTTCAAGGAATAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1135
Summary {0: 1, 1: 3, 2: 79, 3: 341, 4: 711}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117586947_1117586951 -7 Left 1117586947 14:57217621-57217643 CCTCCCTATTCCTTGAAACACAG 0: 1
1: 3
2: 79
3: 341
4: 711
Right 1117586951 14:57217637-57217659 AACACAGTAACATTGCAATTAGG 0: 1
1: 0
2: 4
3: 39
4: 389
1117586947_1117586952 15 Left 1117586947 14:57217621-57217643 CCTCCCTATTCCTTGAAACACAG 0: 1
1: 3
2: 79
3: 341
4: 711
Right 1117586952 14:57217659-57217681 GACAATCAATAATCCTACAATGG 0: 1
1: 2
2: 50
3: 339
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117586947 Original CRISPR CTGTGTTTCAAGGAATAGGG AGG (reversed) Intronic
901890953 1:12264221-12264243 TTGTGTCTCAGGTAATAGGGAGG - Intronic
902165416 1:14567209-14567231 CTGTGGCTCAGGGAATAGGGAGG + Intergenic
902928269 1:19712139-19712161 TTGTGTCTCAGGGAATAGGAAGG + Intronic
903391197 1:22964671-22964693 ATGGGTTTCACAGAATAGGGTGG + Intronic
903561112 1:24228602-24228624 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
903849666 1:26298223-26298245 GTGTGTTTCAAGGATTACAGGGG - Intronic
904202480 1:28830073-28830095 TTGTGTCTCAGGGAATAGAGAGG + Intronic
904259553 1:29280468-29280490 CTGTGCTTCCAGGAAAAGGCTGG - Intronic
904498866 1:30902649-30902671 TTGTGTCTCAAGGGACAGGGTGG - Intronic
904665401 1:32116861-32116883 TTGTATCTCAGGGAATAGGGTGG + Intronic
905144226 1:35874538-35874560 TTGTGTCTCAAGGAATAGGGAGG - Intronic
905783151 1:40730433-40730455 CTGTGTCTCAGGTAATAGGGAGG + Intronic
906463152 1:46052916-46052938 CTTGTTTTAAAGGAATAGGGTGG - Intronic
907182278 1:52581312-52581334 CTGTGAGTAAAGGAATAGGGTGG - Intergenic
907548125 1:55280161-55280183 TTGAGTCTCAGGGAATAGGGAGG - Intergenic
907652373 1:56307589-56307611 TTGCATCTCAAGGAATAGGGAGG - Intergenic
907685077 1:56602702-56602724 TTGTGTCTCAGGGAATAGGGAGG - Intronic
907766123 1:57412236-57412258 CTGTGTCTCAGTGAATTGGGAGG - Intronic
908091652 1:60692159-60692181 TTGTGTCTCAAGGAATAGGGAGG - Intergenic
908333255 1:63093049-63093071 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
908849642 1:68362858-68362880 TTGTGTTTCAGGAAACAGGGAGG + Intergenic
909322078 1:74302307-74302329 TTGTGTCTCAGGGAATAGGTAGG - Intronic
909735590 1:78957183-78957205 TTGTGTCTCAGGAAATAGGGAGG - Intronic
909904852 1:81182239-81182261 TTGTGTGTCCAGGAATAGGGAGG + Intergenic
909964338 1:81889072-81889094 TTGTGTCTCAGGGAATAGGGAGG - Intronic
910018676 1:82557911-82557933 TTGTGTCTCAAGGAATAGAGAGG - Intergenic
910151529 1:84153068-84153090 CTGTGTCTTAGGGAATAGGAAGG + Intronic
910163223 1:84296573-84296595 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
910200443 1:84692835-84692857 CTGTGTCTTAGGGAGTAGGGAGG - Intergenic
910298415 1:85676615-85676637 TTGTGTCTCAAGGAATAGGGAGG + Intronic
910718649 1:90260112-90260134 CTGTGTCTCGGGGAATAGGGAGG - Intergenic
910755674 1:90687867-90687889 TTGTGTCTCAGGGAATAGGGCGG + Intergenic
910782588 1:90956040-90956062 TTGTGTCTCATGGAATAGGGAGG + Intronic
910801361 1:91149973-91149995 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
910845168 1:91598348-91598370 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
910918311 1:92315201-92315223 TTGTGTCTCAAGGAATAGGGAGG + Intronic
910992464 1:93070276-93070298 TTGTGTCTCAGGAAATAGGGAGG - Intergenic
911591408 1:99752413-99752435 TTGTGCCTCAGGGAATAGGGAGG + Intronic
911649640 1:100373230-100373252 TTGTGTCTCAGGGAATAGGGAGG + Intronic
911712694 1:101093521-101093543 CTGTGTCTCAGGGAAAAGGGAGG + Intergenic
911928931 1:103875147-103875169 TTGTATCTCAGGGAATAGGGAGG + Intergenic
911955748 1:104232804-104232826 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
911968524 1:104399189-104399211 ATGTGTCTCAGGGAATAGGGAGG + Intergenic
911969898 1:104419293-104419315 TTGTGTTTCAGGGAATAAGGAGG + Intergenic
911987313 1:104644206-104644228 CTGTGTCTCAGGGCATAGGGAGG - Intergenic
912307182 1:108580324-108580346 TTTTGTCTCAGGGAATAGGGAGG - Intronic
912731469 1:112110338-112110360 CTGTGTCTCAAAGAATAGGGAGG + Intergenic
913317191 1:117563220-117563242 CTCTGTTTCAAGGCAAAGGGAGG + Intergenic
913323555 1:117606761-117606783 CTGAGTTTTAAGGAGAAGGGCGG + Intronic
913345075 1:117800814-117800836 CTGTGTCTCAGGGAATAGTGAGG + Intergenic
914356919 1:146894463-146894485 TTATGTCTCAAGGAATAGGGAGG + Intergenic
914709731 1:150202131-150202153 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
914776295 1:150738853-150738875 TTGTGTCTCAGGGAAAAGGGAGG - Intronic
914777258 1:150749063-150749085 TTGTGTCTCAGGGAACAGGGAGG - Intronic
915090691 1:153422288-153422310 AAGAGTGTCAAGGAATAGGGTGG + Exonic
915600022 1:156916494-156916516 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
916304271 1:163311586-163311608 CTGTGTCTCAGGAAATAGGGAGG + Intronic
916688207 1:167166835-167166857 TTGTGTGTCAAAGAATAGGAAGG - Intergenic
916831895 1:168501784-168501806 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
917192314 1:172431054-172431076 TTGTGTCTCAGGAAATAGGGAGG - Intronic
917238961 1:172926386-172926408 TTGTGTTTCAGGGAATAGGGAGG + Intergenic
917669456 1:177258892-177258914 TTGTGTCTCAGGGAATAGGGAGG - Intronic
917956552 1:180105193-180105215 CCAGGTTTCAAGGAAAAGGGAGG - Intronic
918130697 1:181625967-181625989 TTGTGTCTCAGGGGATAGGGAGG + Intronic
918392104 1:184076450-184076472 CTGTTTCTCAGGGAATAGGGAGG - Intergenic
919148479 1:193664557-193664579 CTGCTTTTCCTGGAATAGGGTGG - Intergenic
919160134 1:193818588-193818610 TTGTGTTTCAGGGTCTAGGGAGG + Intergenic
919487874 1:198166581-198166603 TTGTGTCTCAGGGAATAGTGAGG + Intronic
919545879 1:198917884-198917906 CTGTGTCTCAAGGAAGAAGCAGG - Intergenic
919612810 1:199767105-199767127 TTTTGTTTCAGGGAATAGGGAGG - Intergenic
920024432 1:202982940-202982962 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
920034680 1:203058286-203058308 CTGTGTGTGAAGGAAAGGGGTGG + Intronic
920081463 1:203376902-203376924 GTGTGTCTTAGGGAATAGGGAGG + Intergenic
921091041 1:211843385-211843407 TTGTGCCTCAAGGAATAGGGAGG + Intergenic
921141889 1:212316055-212316077 TTGTGTCTCAGGGAATAGGGAGG - Intronic
921282010 1:213576653-213576675 TTTTGTCTCCAGGAATAGGGTGG - Intergenic
921308221 1:213818120-213818142 TTGTGTCTCAGGGAACAGGGAGG - Intergenic
921379524 1:214510098-214510120 TTGTGTCTCAGGGAATAGGGAGG + Intronic
921537993 1:216375882-216375904 TTGTGTCTCAGGGAACAGGGAGG + Intronic
921713342 1:218394669-218394691 CTGTGTTACATGTAATAGGTGGG + Intronic
921761532 1:218920914-218920936 TTGTGTCTTAAGGAATAAGGAGG + Intergenic
922333151 1:224595495-224595517 TTGTGTTTCAAGGAAAAGAAAGG - Intronic
922659148 1:227414056-227414078 TTGTATCTCATGGAATAGGGAGG + Intergenic
922903129 1:229153808-229153830 TTGTATCTCAGGGAATAGGGAGG + Intergenic
922961073 1:229646007-229646029 CTGTCTTTACAGGAAGAGGGAGG - Intronic
923125713 1:231032898-231032920 CTGAGTCTCAAGGATTCGGGAGG - Intronic
923294119 1:232576506-232576528 TTGTGTCTCAGGGAATCGGGAGG - Intergenic
923717832 1:236440869-236440891 TTGTGTCTCAGGGAATAGGAAGG - Intronic
923898282 1:238297036-238297058 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
924079175 1:240375040-240375062 TTGTGTCTCAGGGAATATGGAGG + Intronic
924168622 1:241312678-241312700 TTGTGTCTCAGGGAATAGAGGGG - Intronic
924287534 1:242503527-242503549 CTGTGCTTCAAGGAAGTGGAGGG - Intronic
1062995624 10:1863607-1863629 TTGTATTTCAGGGAATAAGGAGG - Intergenic
1063000471 10:1913773-1913795 CTATGTTTCAAGGCAGAGTGTGG - Intergenic
1063443282 10:6090107-6090129 CTGTGTTTCCAGGAGTAGTCAGG + Intronic
1063802015 10:9590700-9590722 TTGTGTCTCAAGGAACAGGGAGG + Intergenic
1063802110 10:9591947-9591969 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1064691653 10:17924553-17924575 ATGTGTTTCAAGGACTATAGTGG + Intergenic
1065402725 10:25324359-25324381 TTGTGTGTCAGGGAATAGAGAGG + Intronic
1065654064 10:27928269-27928291 ATGAGTTACAAAGAATAGGGAGG - Intronic
1065687297 10:28299330-28299352 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1065699969 10:28415362-28415384 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1066043366 10:31575652-31575674 TTGTGTCTTAAGGAATATGGAGG - Intergenic
1067119730 10:43463951-43463973 TTGTGTCTCAAGGAATAGGGAGG - Intronic
1068220270 10:54035633-54035655 CTGTGTCTCAGAGAATAGGAAGG - Intronic
1068700385 10:60013660-60013682 TTGTGTCTCAGGGAACAGGGAGG + Intergenic
1068748711 10:60566252-60566274 TTGTATCTCAGGGAATAGGGAGG - Intronic
1068940899 10:62680139-62680161 TTGTGTTTCAGGAAATAGGGAGG + Intergenic
1069012014 10:63385065-63385087 TTGTGTCTCAAGGAATAGGGAGG + Intronic
1069126559 10:64642440-64642462 TTGTGTCTCAGGGAATATGGAGG - Intergenic
1069304019 10:66945812-66945834 ATGTGTCTCAGGGAATAGGGAGG + Intronic
1069398170 10:68012479-68012501 TTGTGCCTCAAGGAATAGGAAGG + Intronic
1069403416 10:68074509-68074531 CTGTGTTTTAAAGAAAAGGGTGG - Intronic
1069480845 10:68780907-68780929 TTTTGTCTCAGGGAATAGGGAGG - Intronic
1069693348 10:70369141-70369163 CTCCTTTTCAAGGAACAGGGTGG + Intronic
1070020010 10:72575798-72575820 CTGTGTCTCAGGGAATGGGAAGG - Intronic
1070218534 10:74413911-74413933 TTGTGTCTCAAGAAATAGGGAGG + Intronic
1071617726 10:87092011-87092033 CTGTGTTTCTAAGACTAGAGTGG + Intronic
1071851648 10:89577718-89577740 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1071854242 10:89607256-89607278 CTGTGTCTCAGGGAATAGGGAGG + Intronic
1071871833 10:89804005-89804027 ATGTATCTCAGGGAATAGGGAGG + Intergenic
1071971181 10:90908718-90908740 TTTTGTTTCAAGGAATGGGGAGG - Intergenic
1072151095 10:92684703-92684725 TTGTCTCTCAAGGAATAAGGAGG - Intergenic
1072912681 10:99517966-99517988 TTGTGCCTCAGGGAATAGGGAGG + Intergenic
1074607284 10:114985824-114985846 TTGTGTCTCAGAGAATAGGGAGG + Intergenic
1074625059 10:115174338-115174360 CTGTGTTTCAAGGACAAATGTGG - Intronic
1074691466 10:116008744-116008766 TTGTGTCACAGGGAATAGGGAGG - Intergenic
1074725597 10:116305416-116305438 TTGTGTCTCAAGCAATAGGGAGG + Intergenic
1075179509 10:120197229-120197251 TTGTGTCTCAGGGAATAGGTAGG + Intergenic
1075186143 10:120259707-120259729 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1075354520 10:121758963-121758985 TTGTGTTTCAGGAAATAGGGAGG - Intronic
1075490740 10:122866782-122866804 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1075841079 10:125504193-125504215 CTGTGTCCCAGGGAATAGGAAGG - Intergenic
1076095386 10:127731082-127731104 TTTTGTCTCAGGGAATAGGGAGG + Intergenic
1076205928 10:128602784-128602806 CTGTGTCTCAGGGCATAGGGAGG - Intergenic
1076549560 10:131269511-131269533 CTATGTCTCAGGGAAGAGGGAGG + Intronic
1076742684 10:132494808-132494830 CTGTGTCTCGGGGAAGAGGGAGG - Intergenic
1076808222 10:132870266-132870288 CTGTGTCTTGGGGAATAGGGAGG - Intronic
1077824719 11:5793790-5793812 TTGTGCCTGAAGGAATAGGGGGG - Intronic
1077949001 11:6933922-6933944 CAGTTTTTAAGGGAATAGGGAGG + Intronic
1077972684 11:7211654-7211676 ATTTCTTCCAAGGAATAGGGAGG - Intergenic
1078117821 11:8472453-8472475 TTGTGTATCAGGGACTAGGGAGG + Intronic
1078193657 11:9115865-9115887 TTTTGTTTCAGGGAATAGGGAGG + Intronic
1078398940 11:11007035-11007057 TTGTGTTTTAGGGAATAGGAAGG + Intergenic
1078584291 11:12567906-12567928 TTTTGTCTCAGGGAATAGGGAGG + Intergenic
1078805197 11:14692750-14692772 CAGTGTCTCAGGGAATAGGGAGG - Intronic
1078995875 11:16698727-16698749 TTGTGTTTCAGGGAATAGAGAGG + Intronic
1079722400 11:23834451-23834473 CTGTGTCTTAGGGAATAGGGAGG + Intergenic
1079890770 11:26050046-26050068 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1080033735 11:27689051-27689073 CTGTGTGCCAAGGAATAAAGTGG - Intronic
1080064451 11:27994252-27994274 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1080070598 11:28080654-28080676 ACGTGTTTCAAGGAATAGGGAGG - Intronic
1080171071 11:29303607-29303629 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1080543866 11:33296788-33296810 TTGTGTCTCAGGTAATAGGGAGG - Intronic
1080749078 11:35136186-35136208 CTGTGTTTCATGGAACCTGGAGG - Intergenic
1080842325 11:35996265-35996287 TTGCGTCTCAAGGAATAGGGAGG + Intronic
1080935226 11:36856525-36856547 CTGTATTTCCAGGAAGAAGGGGG + Intergenic
1081071620 11:38616947-38616969 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
1081186294 11:40046728-40046750 TTGTGTCTCAAGGAATAGGGAGG + Intergenic
1081263094 11:40985351-40985373 TTGTGTTTCAGTTAATAGGGGGG + Intronic
1081485734 11:43526754-43526776 TTGTGCTTCAGGGAATAGGGAGG + Intergenic
1081886636 11:46503287-46503309 CTGTGTATCAGGGAATAGGAAGG + Intronic
1082232864 11:49790372-49790394 TTGTGTCTCTAGGGATAGGGAGG + Intergenic
1082662801 11:55933948-55933970 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1082761841 11:57134772-57134794 TTGTGTCTCAGGGACTAGGGAGG + Intergenic
1082954617 11:58856624-58856646 TTGTGTCTCAGGGAATAGTGAGG + Intronic
1082971667 11:59029310-59029332 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1083040126 11:59677846-59677868 TTGTGTCGCAGGGAATAGGGAGG + Intergenic
1083275270 11:61593546-61593568 GAGTGTTTCAGGGAAGAGGGAGG + Intergenic
1083339185 11:61947647-61947669 CTGCGGTTCAGGGAACAGGGAGG + Intergenic
1083598391 11:63931235-63931257 CAGTGTTTCAAGGAAGAGGGAGG + Intergenic
1083976054 11:66121332-66121354 CTGTATCTCATGAAATAGGGAGG - Intronic
1084011675 11:66353674-66353696 TTGTGTTTCAGGAAATAGGGAGG - Intronic
1084137717 11:67199223-67199245 TTGTGTCTCAGGAAATAGGGAGG - Intronic
1084369235 11:68728038-68728060 TTGTGTCTCAGGGAATATGGAGG - Intronic
1084447139 11:69210203-69210225 CTGTGTTTGAAGGAAGAAGAGGG - Intergenic
1084487744 11:69460678-69460700 CTATGTTTTAGGGAAAAGGGAGG + Intergenic
1084668172 11:70588150-70588172 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1084761486 11:71274822-71274844 CTGTGTCTCAGGGAATGGGGAGG - Intergenic
1085350510 11:75795409-75795431 CTGTGTTACAAGGAATGTGATGG - Intronic
1085367170 11:75959877-75959899 TTGTGTCTCAGGGAATATGGAGG + Intronic
1085616777 11:78006298-78006320 TTGTATCTCAAGGAATAGGGAGG - Intergenic
1086121646 11:83310952-83310974 CTATTTCTCAGGGAATAGGGAGG + Intergenic
1086649729 11:89273320-89273342 CTATGTGTCAGAGAATAGGGAGG + Intronic
1086896961 11:92324430-92324452 CCATGTGTCAGGGAATAGGGAGG + Intergenic
1087493262 11:98855579-98855601 CCATGTTACAAGGAAAAGGGGGG + Intergenic
1087636012 11:100702241-100702263 TTGTGTCTCAGAGAATAGGGAGG + Intronic
1087883269 11:103445521-103445543 CTGTGTATTATGGACTAGGGTGG + Intronic
1088389474 11:109298338-109298360 TTGAGTCTCAGGGAATAGGGAGG + Intergenic
1088439661 11:109855706-109855728 CTGTGTCTCAGGAAGTAGGGAGG - Intergenic
1088439691 11:109856055-109856077 CTGTGTCTCAGGAAATAGGGAGG + Intergenic
1088662063 11:112057235-112057257 TTGTGTCTCATGGAATAGGGAGG - Intronic
1088819947 11:113448402-113448424 CTGTGTTTCCAAGAATAGCCAGG - Intronic
1089415119 11:118282247-118282269 ATGTGTCTCAGGGAATTGGGAGG - Intergenic
1089415257 11:118283797-118283819 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
1089753620 11:120669638-120669660 AAGTGTTTCAAGGAAGAAGGAGG - Intronic
1089823727 11:121252423-121252445 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1090218211 11:124990174-124990196 TTGTGTCTCAGTGAATAGGGAGG + Intronic
1090428217 11:126625030-126625052 CCCTGTTTCAGGGAACAGGGTGG + Intronic
1090468920 11:126961108-126961130 TTGTGTCTCATGGAATAGGGAGG - Intronic
1090818646 11:130320424-130320446 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1091110068 11:132957892-132957914 TTGTGTCTCAGGGAACAGGGAGG - Intronic
1091515581 12:1177497-1177519 TTGTGTTTCAAGGAATAGGAAGG + Intronic
1091869808 12:3879702-3879724 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
1092622948 12:10293425-10293447 TTGTGTTTCAGGGAATTGGGAGG + Intergenic
1092681876 12:10992359-10992381 CTGTGTTTCACAGAATGGAGTGG + Intronic
1092731547 12:11539684-11539706 GTGTGTTTCAGAGAATGGGGAGG + Intergenic
1093306959 12:17532387-17532409 TTTTGTCTCAGGGAATAGGGAGG - Intergenic
1093375667 12:18424638-18424660 CGGTGTGTGAAGGAATAGTGGGG - Intronic
1093450946 12:19312996-19313018 TTGTGTCTCGAGGAATAGGCAGG + Intronic
1093687019 12:22068372-22068394 TTGTGTCTCGGGGAATAGGGAGG + Intronic
1094205357 12:27833904-27833926 TTGTATCTCAAGGAATAGGGAGG - Intergenic
1094250402 12:28353584-28353606 CTGTGTCTCAGAGAATAGAGAGG + Intronic
1094440173 12:30466553-30466575 CTGTGTCTCCAGAAATAGGGAGG + Intergenic
1094632644 12:32191889-32191911 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1094637035 12:32236503-32236525 TTGTGTCTCATGGAATAGGGAGG - Intronic
1095208649 12:39467542-39467564 CTGTGTCTCAGGGAATAGTGAGG - Intergenic
1095284754 12:40395672-40395694 TTGTGTCTCAGGGAAAAGGGAGG + Intronic
1095435496 12:42183215-42183237 TTGTGTCTCAGGGAAGAGGGAGG - Intronic
1095523086 12:43091684-43091706 GTGTATGTCAAGGAATAAGGAGG - Intergenic
1095599998 12:44002948-44002970 CTATTTTTCAAGGAATAAAGAGG + Intronic
1095625661 12:44311459-44311481 TTTTGTTTTAATGAATAGGGTGG + Intronic
1095729039 12:45485568-45485590 TTGTGTATCAGGAAATAGGGAGG - Intergenic
1095922896 12:47548602-47548624 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1096432130 12:51554700-51554722 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1096828456 12:54296913-54296935 GTGGGTGTCAGGGAATAGGGAGG - Intronic
1096906235 12:54938588-54938610 TTGTGTTTCAGGAAATAGGAAGG - Intergenic
1097123663 12:56755540-56755562 TTGTGTCTTAGGGAATAGGGAGG + Intronic
1097163346 12:57066582-57066604 CTGTTTCTCAGGGAATAGGGAGG + Intronic
1097242919 12:57588539-57588561 TTGTGTTTGAAAGAAGAGGGTGG - Intergenic
1097659513 12:62413999-62414021 TTATGTCTCAGGGAATAGGGAGG + Intronic
1097672028 12:62551332-62551354 TTGTATCTCAAGAAATAGGGAGG + Intronic
1097788599 12:63789232-63789254 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1097954732 12:65471999-65472021 TTGTGTCTCAAGAAATAGGGAGG - Intronic
1098075194 12:66722327-66722349 TTGTGTCTCAGGGAATAGGAAGG + Intronic
1098323715 12:69278630-69278652 CTGTCTCTTAAGAAATAGGGAGG - Intergenic
1098800722 12:74953878-74953900 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1099474243 12:83088570-83088592 TTGTGTCTCTAGGAATGGGGAGG + Intronic
1099592412 12:84611614-84611636 TTGTGTCTCAAGGAATAGAAAGG - Intergenic
1100169233 12:91954687-91954709 TTGTGTCTCAGGCAATAGGGAGG - Intergenic
1100256993 12:92894263-92894285 TTGTGTCTCAAGGAATAGGGAGG - Intronic
1100516435 12:95332754-95332776 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1100695623 12:97089695-97089717 TTGTGTTTCAGAGAATAGAGAGG + Intergenic
1100723475 12:97384049-97384071 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
1100922874 12:99509180-99509202 TTGTGTCTCAGGAAATAGGGAGG - Intronic
1100927295 12:99563432-99563454 TTGTGTCTCAGGGAGTAGGGAGG + Intronic
1101620580 12:106383527-106383549 TTGTGTCTCAAGGAATAAGGAGG + Intronic
1101648352 12:106652453-106652475 CTGTGTGCCAAGGAATATGCTGG + Intronic
1102053982 12:109882500-109882522 GTGTGGTGCAAGGAATCGGGGGG + Intergenic
1102816932 12:115873813-115873835 CTGAGTTTCAAGGGATAAGTAGG + Intergenic
1103048131 12:117755598-117755620 TTGTGTTTCAGAAAATAGGGAGG - Intronic
1103254437 12:119528826-119528848 CTGTCCTTCAAGGCATAGAGAGG + Intronic
1103610427 12:122120825-122120847 CTGTCTGTCAGGGAGTAGGGAGG + Intronic
1104488466 12:129172893-129172915 TTGTGTCTCAGGGAATAGGCAGG + Intronic
1105325045 13:19363233-19363255 CTGTATCTCAGGAAATAGGGAGG + Intergenic
1105337712 13:19489019-19489041 TTGTGACTCAGGGAATAGGGAGG + Intronic
1105393010 13:19999527-19999549 CTGTGTCTCAAGGAACAGGGAGG - Intronic
1105614358 13:21998882-21998904 CTGTGTTTCTAGCACTAGGAGGG + Intergenic
1105780065 13:23697787-23697809 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1105868237 13:24480314-24480336 TTGTATCTCAGGGAATAGGGAGG - Intronic
1106456580 13:29933125-29933147 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1106712526 13:32353341-32353363 CTGTGTATTGAGGAGTAGGGAGG - Intronic
1106915486 13:34509346-34509368 TTGTGTCTCAAGGAATAGGAAGG + Intergenic
1106941229 13:34782078-34782100 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1108010344 13:46000913-46000935 TTGTGTCTCAAGGAATACAGAGG + Intronic
1108085848 13:46792230-46792252 CAGTGTTTCTAGGAATAGAAAGG - Intronic
1108700949 13:52943726-52943748 CTCTGTTCCAAGCAATAGGGAGG - Intergenic
1109077181 13:57851072-57851094 CTGTGACTCATGGAATAGGGAGG + Intergenic
1109254696 13:60064926-60064948 CTGTGCTTCAGGGAATAGGGAGG + Intronic
1109265874 13:60199683-60199705 CTGTGTCTCAAGGATTAGGGAGG + Intergenic
1109350478 13:61174191-61174213 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1109681864 13:65762450-65762472 TTGTGCTTCAGAGAATAGGGAGG + Intergenic
1109795825 13:67311892-67311914 TTGTGTTCCAAGGAATTAGGGGG - Intergenic
1109815628 13:67579436-67579458 CTGTGTCTCAGAGAATAGGGAGG + Intergenic
1109870386 13:68324730-68324752 GTGTGTTTCAGGAAATATGGAGG + Intergenic
1110282428 13:73710724-73710746 TTGTGTCTCAAGGAATAGGGGGG - Intronic
1110378996 13:74827933-74827955 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1110521586 13:76485442-76485464 TTGTGTCTCAGGGAATAAGGAGG - Intergenic
1111146316 13:84185492-84185514 ATGTGTCTCATGGAATAGGGAGG + Intergenic
1111384438 13:87505669-87505691 TTGTGTTTCAGGGAGTAGGGAGG + Intergenic
1111467359 13:88632354-88632376 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1111842351 13:93465931-93465953 CTGTGTTTCAGGAAACAGGAAGG + Intronic
1112116180 13:96357471-96357493 TTGTGTCTCAGGGAATAGAGAGG + Intronic
1112208816 13:97352420-97352442 TTTTGTCTCAGGGAATAGGGAGG + Intronic
1112653427 13:101422993-101423015 CCATGTTTCAGGGAATAGAGAGG + Intergenic
1112728814 13:102336010-102336032 TTGTGTTTCAGGGAATAGAGAGG - Intronic
1112856693 13:103779541-103779563 TTGTATCTCAGGGAATAGGGAGG + Intergenic
1113057169 13:106281305-106281327 TTTTGTCTCAGGGAATAGGGAGG - Intergenic
1113137550 13:107110153-107110175 TTGTGTTTCAAGGAATAGAGAGG + Intergenic
1113304435 13:109061500-109061522 CTGTGTTTCAGTGAATAGGGAGG + Intronic
1113611950 13:111652985-111653007 CTGTGTATCCAGGAAGATGGAGG + Intronic
1113695036 13:112339258-112339280 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1114601969 14:23963912-23963934 ATGTGTCTCAGGGAATATGGAGG + Intronic
1114606141 14:23999036-23999058 ATGTGTCTCAGGGAATATGGAGG + Intronic
1114611709 14:24046615-24046637 ATGTGTCTCAGGGAATATGGAGG + Intergenic
1114734287 14:25027566-25027588 TTGTGTCTTAGGGAATAGGGAGG - Intronic
1114950068 14:27739149-27739171 TTGTGTTTCAGGGAATAAGGAGG - Intergenic
1115136304 14:30112782-30112804 TTGTGTCTCAGGGAATGGGGAGG - Intronic
1115195567 14:30795192-30795214 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1115308238 14:31953845-31953867 TTGTGTCACAGGGAATAGGGAGG - Intergenic
1115379146 14:32714071-32714093 TTGTGTCTCAAGGAATAGGAAGG + Intronic
1115486806 14:33918317-33918339 TTGTGTCTTAGGGAATAGGGAGG - Intergenic
1115622054 14:35150289-35150311 TTGTGTCTCAGGTAATAGGGAGG + Intronic
1115709536 14:36035679-36035701 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
1115898133 14:38113754-38113776 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1116101250 14:40439730-40439752 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1116144253 14:41043339-41043361 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
1116224809 14:42136774-42136796 CTTTGTTTCAAAGAATAAAGGGG - Intergenic
1116476192 14:45342598-45342620 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1116499460 14:45602652-45602674 TTGTGTTCCAGGGAATAGAGAGG + Intergenic
1116562147 14:46394013-46394035 TTGTATCTCACGGAATAGGGAGG - Intergenic
1116592352 14:46794335-46794357 CTGTGTCTCAGAGAATAGGCAGG + Intergenic
1116687984 14:48066993-48067015 CTGTGTCTCAGAGAATAGAGAGG + Intergenic
1117074242 14:52085688-52085710 CTGTGCCCCAGGGAATAGGGAGG + Intergenic
1117084940 14:52190471-52190493 TTGTGTCTCAGGGACTAGGGAGG - Intergenic
1117269583 14:54128505-54128527 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1117401452 14:55362180-55362202 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
1117464647 14:55980423-55980445 TTGTGTCTCAGGGAATGGGGAGG - Intergenic
1117586947 14:57217621-57217643 CTGTGTTTCAAGGAATAGGGAGG - Intronic
1117662757 14:58024787-58024809 TTTTGTCTCAGGGAATAGGGAGG + Intronic
1117764483 14:59066788-59066810 TTGTGTTTCAAGGAATAGAGAGG + Intergenic
1117932317 14:60855956-60855978 TTGTGTCTAAAGGAATAGGGAGG - Intronic
1118045254 14:61963121-61963143 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
1118176708 14:63447861-63447883 TTGTGTCTCGGGGAATAGGGAGG + Intronic
1118507724 14:66432466-66432488 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1118560436 14:67074499-67074521 CTGTGTCTCAGAGAATAGGGAGG - Intronic
1118662612 14:68030898-68030920 TTGTGTCTCAAGGAATAGGAAGG + Intronic
1119308327 14:73625827-73625849 TTTTGTCTCAGGGAATAGGGAGG - Intergenic
1119945619 14:78690604-78690626 CAGTGTCAGAAGGAATAGGGTGG + Intronic
1119964239 14:78895795-78895817 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1120174999 14:81284134-81284156 CTTTGTCTCAGGGAATAAGGAGG - Intronic
1120264696 14:82234017-82234039 CTGTATCTCAGGGAATAGGGAGG - Intergenic
1120329294 14:83068955-83068977 GTGTGTCTCAAGGAATAGCAAGG + Intergenic
1121018738 14:90565806-90565828 CTGTGTCTCAGGGAATAGGGAGG + Intronic
1122170403 14:99869460-99869482 TTGTGTCTCAGGGAAAAGGGAGG - Intronic
1122734073 14:103825247-103825269 ATGTGTCTCAGGGAATAGGGAGG - Intronic
1123027040 14:105430296-105430318 TTGTGTCTCAGGGAATAGAGAGG + Intronic
1124093337 15:26626308-26626330 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1124405645 15:29389422-29389444 CAGTGTTTCCAGGATTGGGGAGG - Intronic
1124560428 15:30768966-30768988 TTGTGTCTCAAGGAATACGGAGG + Intronic
1124639268 15:31385732-31385754 TTGTGTCTTAGGGAATAGGGAGG - Intronic
1124670783 15:31636475-31636497 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1124950342 15:34313029-34313051 TTGTGTCTCAGTGAATAGGGAGG - Intronic
1125099580 15:35895651-35895673 TTGTGTCTCAGGGAACAGGGAGG + Intergenic
1125453684 15:39835621-39835643 CTGTATTTCAGGAATTAGGGTGG + Intronic
1125822748 15:42646920-42646942 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1125875350 15:43139336-43139358 TTGTGTCTCAGGGAATGGGGAGG - Intronic
1125981365 15:44004675-44004697 TTGTGTCTCAGGGTATAGGGAGG - Intronic
1126307385 15:47275681-47275703 TTTTGTCTCAGGGAATAGGGAGG - Intronic
1127032541 15:54880039-54880061 TGATGTTTAAAGGAATAGGGAGG - Intergenic
1127447123 15:59074932-59074954 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1127705205 15:61540083-61540105 TTGTGTTTCATGGAATAGGGAGG + Intergenic
1127757431 15:62106213-62106235 GTGTGTCTCAGGGAATAGCGAGG - Intergenic
1128189941 15:65682822-65682844 TTGTGTCTCAAGGAATAAGAAGG + Intronic
1128685697 15:69683713-69683735 ATGTGTTTCAAGGAATAGGAAGG + Intergenic
1128690160 15:69718354-69718376 TTGTGTTTCAAGGAATGGGGAGG + Intergenic
1128722583 15:69961611-69961633 TTGTGTCTCAAAGAATAGGGAGG - Intergenic
1128969484 15:72094999-72095021 GTGTGTTTCAGGCAATAGTGAGG - Intronic
1129499300 15:76020200-76020222 TTGTGTCTCAGGGAATAGAGAGG - Intronic
1129575447 15:76738615-76738637 CTGTGTCTCAGGGAATAAGGAGG + Intronic
1131169671 15:90168655-90168677 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1131756567 15:95570031-95570053 GTGTATCTCAAGGAATAGGCAGG + Intergenic
1131909942 15:97187283-97187305 TTGTGCCTCAGGGAATAGGGAGG + Intergenic
1133093075 16:3420165-3420187 TTGTGTCTCAGGGAAAAGGGAGG + Intronic
1133401937 16:5494523-5494545 CTGTGGTCCAAGGATGAGGGAGG + Intergenic
1133443448 16:5839757-5839779 CTGTGTTTCAAGGCAGGAGGTGG + Intergenic
1134351445 16:13441501-13441523 CTGTGTTCCATGGGATAGGCTGG - Intergenic
1137462116 16:48674255-48674277 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1138966990 16:62096390-62096412 CTGTGATTCATGGCAGAGGGTGG - Intergenic
1139082078 16:63534560-63534582 TTGTGTTTCAGGAATTAGGGAGG + Intergenic
1139125915 16:64077136-64077158 TTATGTTTCAGGGAATAGGGAGG - Intergenic
1139141547 16:64269251-64269273 CTGTGTAATTAGGAATAGGGAGG + Intergenic
1140574670 16:76152695-76152717 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1140666139 16:77229433-77229455 CTCTGTTTCAAAAAAAAGGGTGG - Intergenic
1140872295 16:79118217-79118239 TTGTGTCTCAGGTAATAGGGAGG + Intronic
1142616244 17:1137434-1137456 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1142953046 17:3499766-3499788 TTGTGTCTCAAGGAACAGGGAGG - Exonic
1144265674 17:13566395-13566417 TTGTGTCTCAGGTAATAGGGAGG - Intronic
1145277723 17:21444504-21444526 CTGCATCTCAGGGAATAGGGAGG + Intergenic
1145315555 17:21730382-21730404 CTGCATCTCAGGGAATAGGGAGG + Intergenic
1145713990 17:27002321-27002343 CTGCATCTCAGGGAATAGGGAGG + Intergenic
1145717568 17:27036653-27036675 TTGTGTCTCAGGGACTAGGGAGG + Intergenic
1145726872 17:27137275-27137297 TTGTGTCTCAAGGAATAGAGAGG - Intergenic
1146042969 17:29474522-29474544 TTGTGTCTCAGAGAATAGGGAGG + Intronic
1146115494 17:30134105-30134127 TTGCGTCTCAAGGAATAGGAAGG + Intronic
1146838191 17:36129187-36129209 TTGTGTTTAAGGGAATAAGGAGG - Intergenic
1147049383 17:37780078-37780100 TTGTGTCCCAGGGAATAGGGTGG - Intergenic
1147058826 17:37857364-37857386 CTGTGTCTTAAGGAATAGGGAGG + Intergenic
1147911350 17:43858072-43858094 TTGTGTTTAAAGGAATGGAGTGG - Intronic
1148696229 17:49560704-49560726 ATGTGTCTAAAGGAATAGGAAGG - Intergenic
1149192100 17:54075187-54075209 TTGTATCTCAAGGAATAGAGAGG - Intergenic
1149809616 17:59655233-59655255 TTGTGTCTCAGGTAATAGGGAGG + Intronic
1150198675 17:63329778-63329800 TTGTGTCTCAGAGAATAGGGAGG - Intronic
1150468137 17:65412784-65412806 CTGTTTCTCAGGGAACAGGGAGG + Intergenic
1150833948 17:68548028-68548050 TTGTGTCTTAGGGAATAGGGAGG + Intronic
1150866678 17:68857938-68857960 TTGTGTCTCAGGGAATGGGGAGG - Intergenic
1150947988 17:69767879-69767901 TTGTGTCTCAGGGAATTGGGAGG - Intergenic
1151377676 17:73702276-73702298 CTGTGTCTCAGAAAATAGGGAGG + Intergenic
1151583609 17:74994547-74994569 CTGTGTCCTAAGGAATTGGGCGG + Intronic
1151793024 17:76321613-76321635 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1152105333 17:78325376-78325398 CTTTATTTCAGGGAAGAGGGTGG + Intergenic
1152902551 17:82951768-82951790 TTGTGCCTCAGGGAATAGGGAGG + Intronic
1153126520 18:1798533-1798555 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1153133177 18:1881373-1881395 CTGTGTCTCAGGGGATAGGGAGG + Intergenic
1153175437 18:2367011-2367033 TTGTGTCTCAGGGAATAAGGAGG - Intergenic
1153323469 18:3795215-3795237 GTCTGTTTCAAGGAATTTGGGGG - Intronic
1153794212 18:8608204-8608226 CTGTGTTTCAAATAATATAGAGG + Intergenic
1153977080 18:10278761-10278783 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
1154227649 18:12521950-12521972 TTGTGTCTCACGGAATAGGGAGG - Intronic
1154471013 18:14701487-14701509 TTGTGTCTCACGGACTAGGGAGG - Intergenic
1155137623 18:23011876-23011898 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1155296079 18:24385604-24385626 ATGTGTTTCAGGGAATGGGATGG + Intronic
1156181794 18:34613287-34613309 CTGTGTCTCAGAGAATAGGGAGG - Intronic
1156379021 18:36540710-36540732 GTGTGATTCAAGGAAGAAGGTGG + Intronic
1157337483 18:46752211-46752233 CTGTGTTTCAAGGTACATGGAGG - Intronic
1157371842 18:47120799-47120821 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1157783616 18:50462296-50462318 CTGCATTTCAAGGAATAGCAGGG - Intergenic
1158536358 18:58311603-58311625 CTGTCTTGAAAGGAATAGGGTGG + Intronic
1158582111 18:58692507-58692529 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1158978151 18:62731512-62731534 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1159121201 18:64173544-64173566 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1159145994 18:64454835-64454857 CAATGTCTCAAGGAATAGGAAGG + Intergenic
1159740677 18:72166086-72166108 TTGTGTCTTAAGGAATAGGGAGG - Intergenic
1159819390 18:73120706-73120728 CTCTGTTTCCAAAAATAGGGGGG - Intergenic
1160048815 18:75412659-75412681 CTGTGACTCAAGGCACAGGGAGG - Intronic
1160218105 18:76951890-76951912 TTGTGTCTCAGAGAATAGGGAGG + Intronic
1160311163 18:77791601-77791623 CTGTGTTTCAATGAACAAGGAGG - Intergenic
1160520289 18:79504367-79504389 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1160546484 18:79660204-79660226 TTCTGTCTGAAGGAATAGGGAGG + Intergenic
1160552069 18:79700127-79700149 TTATGTCTCAGGGAATAGGGAGG - Intronic
1162268308 19:9594249-9594271 ATGACTTTCAAGGAATAGGGGGG - Intergenic
1163135309 19:15306675-15306697 TTGTGTCTCAAGGAATAGAGAGG + Intronic
1164202280 19:23028898-23028920 CTGTTTTTCAAGGAATGGAAAGG + Intergenic
1164940160 19:32246006-32246028 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1166321338 19:42021160-42021182 CTGTGTGACGAGGAATGGGGTGG - Intronic
1166776056 19:45313438-45313460 ATGTGTCTCAGGGAATACGGAGG - Intronic
1167397573 19:49241288-49241310 GTGTGTCTCAGGGAATAGGTAGG + Intergenic
1168255972 19:55165575-55165597 CTGTGTTTGAAGGAAGAGGCTGG - Intronic
1168652833 19:58103653-58103675 TTTTGTCTCAGGGAATAGGGAGG - Intronic
925200462 2:1964133-1964155 TTGTGTCTCAGGGAATAGGAAGG + Intronic
925527883 2:4823737-4823759 CAGTGTCTCAGGGAATAGGGAGG - Intergenic
925606122 2:5661995-5662017 CTGTGTTTCAACAAATAGGGAGG + Intergenic
925658246 2:6173519-6173541 TTGTGTTTCAGTGAATAGGAAGG - Intergenic
925854063 2:8112544-8112566 TTGTGTCTCAGGAAATAGGGAGG - Intergenic
926387968 2:12356597-12356619 TTGTATCTCAGGGAATAGGGAGG + Intergenic
926449983 2:12991237-12991259 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
926608423 2:14921154-14921176 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
926722271 2:15969851-15969873 TTGTGTTTCAGGGAATAGGGAGG + Intergenic
927014377 2:18942429-18942451 TTGTGTTTCATGAAATAGGAAGG + Intergenic
927755324 2:25703942-25703964 TTGTATGTCAGGGAATAGGGAGG - Intergenic
928046144 2:27934446-27934468 CTGTGTCTCAGGGAATAAGGAGG - Intronic
928227177 2:29460729-29460751 ATGTGTCTCAAGGAATAGAAAGG - Intronic
928657240 2:33464924-33464946 TTGTGTCTCAGGGAATAGGAAGG - Intronic
928720077 2:34110322-34110344 TTCTGTCTCAAGGAATAGGGAGG - Intergenic
929757774 2:44781756-44781778 TTGTGTCTCAGAGAATAGGGAGG - Intergenic
929803361 2:45123292-45123314 CTCTGTTTCAAGCAGTAGGAAGG + Intergenic
929842188 2:45479177-45479199 TTGTGTGTCGGGGAATAGGGAGG - Intronic
929910639 2:46086667-46086689 CTGATGTTCAAGGAAGAGGGTGG - Intronic
929939161 2:46318136-46318158 TTGTGTCTCAGGGAATAGGAAGG + Intronic
930831343 2:55746856-55746878 CTGTGTCTCGGGGAATAGGGAGG - Intergenic
931119213 2:59197828-59197850 ATGGGTTTTAAGGAAAAGGGAGG + Intergenic
931141923 2:59468833-59468855 TTGTGTTTCAGGGAATGGGGAGG + Intergenic
931895270 2:66721782-66721804 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
931924843 2:67060866-67060888 TTGTGTCTCAGGGTATAGGGAGG + Intergenic
932052572 2:68413535-68413557 TTGTGTTTCAGAGAATAGTGAGG - Intergenic
932286462 2:70537275-70537297 TTGTGTCTCAGGGAATAGGGAGG - Intronic
933171023 2:79125290-79125312 TTGTGTTTCTGGGAATAGGGAGG + Intergenic
933266687 2:80188609-80188631 CTGTGAGCCAAGGAATTGGGTGG - Intronic
935168903 2:100594587-100594609 CTGTGTCTCAGGCAATAGGGAGG + Intergenic
935176092 2:100649766-100649788 TTGTGACTCAGGGAATAGGGAGG - Intergenic
935295317 2:101644225-101644247 TTGTGCCTCAAGGAAAAGGGAGG + Intergenic
935608241 2:104992446-104992468 TTGTGTCTCAGAGAATAGGGAGG - Intergenic
935974290 2:108562196-108562218 TTGTGTCTCAGGGAATAGGGAGG - Intronic
935984389 2:108658689-108658711 CTGTGTTTTAAGGTGTAGTGAGG + Intronic
936136827 2:109902337-109902359 CTGTGTTTTAAGGTGTAGTGAGG + Intergenic
936207870 2:110469148-110469170 CTGTGTTTTAAGGTGTAGTGAGG - Intronic
936257054 2:110925974-110925996 TTGTGTCTCAGGGAATAGAGAGG + Intronic
936583503 2:113728580-113728602 CTGTGATTTAGGGAATAGGTAGG - Intronic
936719793 2:115237425-115237447 CTGTGTATCAGGGAGTATGGAGG - Intronic
937538225 2:122917139-122917161 CTTTGTTCCAAGGAAGAGGTAGG - Intergenic
937540557 2:122946909-122946931 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
937818537 2:126281039-126281061 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
937830331 2:126413601-126413623 CTGTGTTTCAGGGAGTAGGGAGG + Intergenic
938173008 2:129099009-129099031 CTGTGTTTCCAGGAATATGTAGG + Intergenic
938311583 2:130292692-130292714 TTGGGTCTCAGGGAATAGGGAGG + Intergenic
938562538 2:132487054-132487076 TTGTGTCTCAGGGAATACGGAGG + Intronic
938681947 2:133701169-133701191 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
938705772 2:133924215-133924237 CTGTGAGTCAAGGAATGTGGTGG + Intergenic
939035555 2:137126871-137126893 TTGTGTCTCCAGAAATAGGGAGG + Intronic
939132180 2:138249314-138249336 TTGTGTTTTATGGAATAGGGAGG + Intergenic
939653359 2:144791366-144791388 TTGTGTCTCGGGGAATAGGGAGG + Intergenic
939889222 2:147716411-147716433 CTTTGTTTCAAGGAACATTGTGG - Intergenic
940126850 2:150335738-150335760 TTGTGTGTCAGGAAATAGGGAGG - Intergenic
940184809 2:150972177-150972199 CTGTGTCTCAGGGAAGAGGGAGG + Intergenic
940756642 2:157690467-157690489 TTGTGTTTCAGGGAATAGGGAGG + Intergenic
940880271 2:158939986-158940008 TTGTGTTTCAGAGAATGGGGAGG - Intergenic
941077481 2:161022278-161022300 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
941733026 2:168940052-168940074 TTGTGTCTCAGGTAATAGGGAGG - Intronic
941921083 2:170851480-170851502 CTCTGTTTCAAGGAGAAGAGAGG - Intronic
941925492 2:170890106-170890128 CTGTGTTTCAAGGGACAAGCTGG - Intergenic
942507768 2:176661570-176661592 TTGTATCTCAGGGAATAGGGAGG - Intergenic
942999310 2:182304645-182304667 TTGTGTCTCAAAGAATAGGAAGG + Intronic
943083918 2:183289270-183289292 ATGTGTCTCAAGGAATAGGGAGG - Intergenic
943123430 2:183766664-183766686 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
943246991 2:185467355-185467377 TTGTCTTTCAAAGAATAGGAAGG + Intergenic
943285853 2:185999129-185999151 TTGTGTTACAGGGAATAGGGAGG - Intergenic
943292833 2:186097049-186097071 TTGTGTCTCAGGGAATAGGGTGG - Intergenic
943330904 2:186557978-186558000 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
943531672 2:189089905-189089927 TTGTGTCTCAGGGAATAAGGAGG - Intronic
943905698 2:193499176-193499198 TTGTGTTTCAGGGAATAGGGAGG - Intergenic
943935458 2:193909673-193909695 CTGTGTTTCATGGAATAGCGTGG - Intergenic
944338106 2:198562093-198562115 TTGTGTCTCAGGGAATAGGGAGG - Intronic
944529578 2:200654023-200654045 TTGTGTCTCAGGGAATAGGGAGG - Intronic
944956611 2:204819479-204819501 TTGTGTCTCAAGGAAGAGAGAGG - Intronic
945126191 2:206513068-206513090 TTGTGTTTCATGGAATAAGGAGG - Intronic
945189329 2:207169904-207169926 TTGTGTCTTAACGAATAGGGAGG - Intergenic
945213730 2:207411713-207411735 ATGTGTCTCAGGGAATAGGGAGG - Intergenic
945442813 2:209900534-209900556 CTGTGTCTCAGGGAATAGGGAGG - Intronic
945541711 2:211095920-211095942 TTGTGTCTCAGGGATTAGGGAGG - Intergenic
946063130 2:216962144-216962166 TTGTGTCTCATGGAATAGGGAGG - Intergenic
946747091 2:222856893-222856915 CTGTGTCTCAGGGGATAGGGAGG - Intergenic
946853180 2:223927892-223927914 TTGTGTCTCAGGGAATAAGGAGG + Intronic
946901252 2:224374040-224374062 TTGTGTCTCAAGGAGTAGGAAGG - Intergenic
947050374 2:226035931-226035953 GTTTGTCTCAGGGAATAGGGAGG - Intergenic
947754175 2:232549917-232549939 TTGTGTCTCAGGGAATAGGGAGG + Exonic
947786308 2:232824135-232824157 ATGTGTCTCAGCGAATAGGGAGG - Intronic
948107149 2:235423719-235423741 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1169090244 20:2856167-2856189 GTGTGTCTCAGGGAATAGGAAGG + Intronic
1169485201 20:6024519-6024541 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1169836696 20:9888254-9888276 TTGTGTCTCAAGGATTAGAGAGG + Intergenic
1170247063 20:14233000-14233022 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1171145994 20:22783088-22783110 CTATGTCTCAGAGAATAGGGAGG - Intergenic
1171236682 20:23532753-23532775 CTGTGTTTCAGGGAATAGGGAGG + Intergenic
1171251335 20:23650992-23651014 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1172012933 20:31856924-31856946 GAGTGTTTCAAGGAGGAGGGAGG + Intronic
1172236343 20:33378241-33378263 TTGTGTCTCAGAGAATAGGGAGG + Intronic
1173882531 20:46427220-46427242 CTGTGTCTCAGGGAATAGGGAGG - Intronic
1173910728 20:46668071-46668093 TTGTATCTCAGGGAATAGGGAGG - Intronic
1173942073 20:46919932-46919954 TTGTGTTTCACGGAATGGGGAGG + Intronic
1174025763 20:47572944-47572966 CTGTGTCTCAGGGAATAAGGAGG + Intronic
1174673189 20:52327551-52327573 TTGTGTCTCTGGGAATAGGGAGG - Intergenic
1174692530 20:52521868-52521890 TTGTGTCTCAAGAAGTAGGGAGG + Intergenic
1175025576 20:55898982-55899004 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1175030233 20:55946144-55946166 CTGTATTTCAAGGAACAGGACGG + Intergenic
1175511130 20:59526884-59526906 ATGTGTTTCAATGAGTAGGCTGG + Intergenic
1176735853 21:10546372-10546394 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1176945073 21:14970058-14970080 TTGTTTTTCAGGGAGTAGGGAGG + Intronic
1177109346 21:17005813-17005835 TTGTGTCTCAGGAAATAGGGAGG - Intergenic
1177162504 21:17563383-17563405 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1177842285 21:26248270-26248292 ATGTGTTTTAAGGTATTGGGAGG - Intergenic
1177869223 21:26550320-26550342 TTGTGTTTCAGGGAGGAGGGAGG - Intronic
1178100531 21:29264030-29264052 TTGTGTCTCAAGGAACAGGGAGG + Intronic
1178152335 21:29809853-29809875 TTGTGTCTCAAGAAATAGGGAGG + Intronic
1178382048 21:32118616-32118638 TTGTGTGTCAGTGAATAGGGAGG + Intergenic
1178437208 21:32570401-32570423 TTGCGTTTCAGGGAACAGGGAGG - Intergenic
1178441935 21:32605406-32605428 CTGGGTTTCAAGGAAGGGGCTGG + Intronic
1178498326 21:33105383-33105405 CTGTGTTTCAATGATGGGGGAGG - Intergenic
1179148715 21:38792478-38792500 TTGTGCCTCAAGGAATAAGGAGG + Intergenic
1179814222 21:43893695-43893717 CTGTGTAACAGGGAATAGGGAGG + Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180878960 22:19190283-19190305 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1180887772 22:19259715-19259737 TTGTGTCTCAGGGAATAAGGAGG - Intronic
1180932578 22:19603196-19603218 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1181515795 22:23411515-23411537 TTGTGTGTCAGAGAATAGGGAGG - Intergenic
1181738468 22:24900692-24900714 CTGTATTTAAAGAAATAAGGCGG - Intronic
1181855100 22:25775617-25775639 GTGTGTTTCCAGGAAGAGGGAGG - Intronic
1182566281 22:31202473-31202495 CTGTGTACCAAGGACCAGGGTGG - Intronic
1183533298 22:38376498-38376520 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1183757886 22:39787282-39787304 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1185262141 22:49873322-49873344 GTGTGTCTCAGGGAAGAGGGAGG + Intronic
949171932 3:1010255-1010277 ATGTGTTTCTTGGAATAGGCTGG - Intergenic
949270194 3:2207200-2207222 TTGTGTCTCAGAGAATAGGGAGG - Intronic
949438360 3:4053169-4053191 TTGTGTCTCAGGGAATAGGGAGG + Intronic
949456995 3:4249617-4249639 CTGTGTCTCAGGGAATTGGGAGG - Intronic
950112668 3:10429612-10429634 TTGTGTCTCAGGGAATAGGGAGG - Intronic
950315003 3:11994249-11994271 CTGTGTCTCAGGGAATAGAGAGG + Intergenic
950562118 3:13737426-13737448 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
950632423 3:14291617-14291639 TTGTGTTTCAGGAAATAGGGAGG - Intergenic
950976352 3:17249749-17249771 CCAAGTCTCAAGGAATAGGGAGG + Intronic
951042954 3:18008420-18008442 TTGTGTCTCAGGGAATAGGGAGG + Intronic
951096793 3:18641701-18641723 TTGTGTCTCAGTGAATAGGGAGG + Intergenic
951276152 3:20688661-20688683 TTGTGTTTCAGGGAATAGGGAGG + Intergenic
951307219 3:21079683-21079705 TTGTATTTCAGGGAATAGGGAGG + Intergenic
951313217 3:21156010-21156032 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
951851800 3:27149681-27149703 TTGTGTCTCAGGGAATAGGAAGG - Intronic
952119431 3:30224299-30224321 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
952365494 3:32671274-32671296 CTGTGTCTCAGGGGATAGGAAGG + Intergenic
952593511 3:34987595-34987617 TTGTGTCTCAGCGAATAGGGAGG - Intergenic
952660271 3:35837797-35837819 GTGTGTCTCAGGGAATAGGGAGG + Intergenic
952774854 3:37035435-37035457 TTGCGTCTCAAGGAATAAGGAGG - Intronic
952809964 3:37393127-37393149 TTGCATCTCAAGGAATAGGGAGG - Intronic
952899925 3:38103770-38103792 TTGTGTCTCAAGGAATAGGGAGG + Intronic
953121671 3:40049560-40049582 TTGTGTCTCAGGGAATAAGGAGG - Intronic
953367222 3:42355422-42355444 TTGTGAATCAGGGAATAGGGAGG - Intergenic
953551643 3:43908013-43908035 CTTTGATTCAAGAAATAGAGCGG + Intergenic
953898973 3:46828105-46828127 CTGTGTTCCAAGGGATGGGCTGG - Intergenic
955010222 3:55006602-55006624 CTGTGATTCAAGGAATGATGTGG + Intronic
955164522 3:56497894-56497916 CTGTGTTTCAGGGAATAGGGAGG + Intergenic
955290350 3:57686794-57686816 TTGTGTCTTACGGAATAGGGAGG - Intronic
955354443 3:58219016-58219038 TTATGTTTCAAGGAAGAGGAAGG - Intergenic
955382277 3:58449151-58449173 TTGTGTCTCAAGGAATAGAAAGG + Intergenic
955416608 3:58697846-58697868 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
955426576 3:58797035-58797057 CTGTGCCTCAGGGAATAGGTAGG - Intronic
955559089 3:60169429-60169451 CTTTGTTTCATTGCATAGGGAGG + Intronic
955678295 3:61472614-61472636 TTGTGTCTCAAGGAATAGATAGG + Intergenic
955831009 3:63004082-63004104 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
955969811 3:64427098-64427120 TTGTGTCTCATGGAATAGGGAGG - Intronic
956079208 3:65539642-65539664 CTTTGTGTCTAGGAATAGTGTGG - Intronic
956098205 3:65739680-65739702 TTGTGGCTCACGGAATAGGGAGG + Intronic
956395207 3:68818640-68818662 TTGTGTCTCAGGGAATAGGAAGG + Intronic
957233530 3:77553357-77553379 TTGTGTCTCGAGGAATAGGGAGG - Intronic
957334877 3:78815121-78815143 TTGTGTCTCAGGGAATAGGAAGG - Intronic
957400882 3:79712054-79712076 TTGTGTGTCAGGGAATAGGGAGG - Intronic
957675077 3:83355565-83355587 CTGTTTTTTAAGGAATAGAAAGG + Intergenic
957679238 3:83410295-83410317 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
958121630 3:89297380-89297402 ATGTGTCTCAGGGGATAGGGAGG + Intronic
958530077 3:95317009-95317031 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
958718295 3:97814070-97814092 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
958832191 3:99102955-99102977 CTTTGTTTCAAGGGGTAGAGAGG - Intergenic
958933084 3:100228508-100228530 TTATGTCTCAGGGAATAGGGAGG - Intergenic
959031230 3:101301034-101301056 CTGTAACTCAGGGAATAGGGAGG + Intronic
959039117 3:101400689-101400711 CTGTGTCTCAGGGGATAGGGAGG - Intronic
959511189 3:107214253-107214275 TTGTGTCTCAGGGAAAAGGGAGG - Intergenic
959799960 3:110481441-110481463 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
959873531 3:111355541-111355563 CTCTGTCTCAGGGAATAGGAAGG - Intronic
960154612 3:114286161-114286183 TTGTGCCTCAGGGAATAGGGAGG + Intronic
960476397 3:118134649-118134671 TTGTGTTTCAGGGAATAGAGAGG - Intergenic
960599431 3:119441125-119441147 TTGTGTTTTAGGGAATAGGGAGG - Intronic
960648078 3:119912164-119912186 TTGTCTCTCAGGGAATAGGGAGG + Intronic
960946717 3:122971888-122971910 CTCTGTTTCAAAGAGAAGGGAGG - Intronic
961396332 3:126594125-126594147 CTGTGTCTCAGGGAATAGGGAGG + Intronic
961445385 3:126978209-126978231 CTGTGTGCCAAGGGACAGGGAGG + Intergenic
961492317 3:127264423-127264445 CTCTGTTTAAAGAAAGAGGGAGG - Intergenic
961613154 3:128156813-128156835 TTGTGTCTCAGGGAATAGGGAGG - Intronic
961733182 3:128982753-128982775 GTGTATCTCAGGGAATAGGGAGG + Intronic
962070425 3:132028209-132028231 CTGTATTTCAAGGAAACAGGTGG - Intronic
962173862 3:133131628-133131650 TTGTGTCTCAGGGAATAGGGAGG - Intronic
962544129 3:136414886-136414908 TTTTGTCTCAGGGAATAGGGAGG + Intronic
962836847 3:139197105-139197127 TTGTATTTCAGAGAATAGGGAGG + Intronic
963054027 3:141169264-141169286 CTGTTTCTCAGGGAAGAGGGAGG - Intergenic
963243023 3:143029567-143029589 TTGTGTCTCAGGAAATAGGGAGG - Intronic
963336784 3:143984474-143984496 TTGTGTCTCAGGGAACAGGGAGG + Intronic
963510713 3:146244691-146244713 TTTTGTCTCAGGGAATAGGGAGG - Intronic
963946504 3:151151555-151151577 TTGTGTCTCAGGAAATAGGGAGG + Intronic
964019125 3:151985601-151985623 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
964041966 3:152270907-152270929 TTGTGTTTTAAGGAACAGGTTGG + Intronic
964105482 3:153034983-153035005 CTTTATTTCAAGCAATAGGCTGG + Intergenic
964145328 3:153454431-153454453 AAGTGTTTCAATGAATAGAGAGG - Intergenic
964146627 3:153471826-153471848 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
964185968 3:153943093-153943115 TTGTGTCCCAGGGAATAGGGAGG + Intergenic
964823299 3:160797389-160797411 TTGTGTCTCAGGGAATAGGGAGG - Intronic
964909407 3:161760210-161760232 TTGTGCCTCAGGGAATAGGGAGG - Intergenic
964989781 3:162794877-162794899 TAGTGTTTCAGGGAATAGGAAGG + Intergenic
965255667 3:166406630-166406652 TTCTGTCTTAAGGAATAGGGAGG + Intergenic
965352266 3:167628171-167628193 TTGTGTCTCAAAAAATAGGGAGG - Intronic
965438683 3:168685749-168685771 TTGTGTTTCAGGGTATAGGGAGG - Intergenic
965886695 3:173454956-173454978 TTGTGTCTTAGGGAATAGGGAGG + Intronic
966095967 3:176203474-176203496 TTGTGTCTCAGGGAATGGGGAGG - Intergenic
966098209 3:176231809-176231831 CTGTGTTTCAGGGAATAAGGAGG + Intergenic
966106107 3:176335807-176335829 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
966214322 3:177486385-177486407 TTGTGTCTGAGGGAATAGGGAGG + Intergenic
966503037 3:180667670-180667692 TTGTGTTTCAAGGAATAGAGAGG - Intronic
966644720 3:182231645-182231667 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
966814005 3:183874287-183874309 TTGTGTTCCAAGGAATAGGGGGG - Intronic
967572059 3:191041251-191041273 TTGTGTTTCAGAGAATAGGGAGG - Intergenic
967727186 3:192872806-192872828 CTGTTTTTAAAGACATAGGGTGG - Intronic
967766559 3:193286677-193286699 TTGTCTCTCAAGGAATAGGGAGG - Intronic
968137932 3:196232494-196232516 CTGGTTTTAGAGGAATAGGGAGG - Exonic
968438082 4:605669-605691 CTGTTTCTCAGGGAATAGCGAGG - Intergenic
968485853 4:861145-861167 TTGTGTCTCGGGGAATAGGGAGG - Intronic
968766265 4:2471424-2471446 TTGTGTCTCAAGGAATTGAGAGG - Intronic
969217893 4:5736816-5736838 CTGTGTCTCAAGAAATAGGGAGG - Intronic
969280001 4:6163505-6163527 TTGTGTCTCAGGGAATGGGGAGG - Intronic
970390404 4:15604299-15604321 TTGTGTCTCTAGGAAGAGGGAGG + Intergenic
970528786 4:16960742-16960764 TTGTGTCTCAGGGAATATGGAGG - Intergenic
970605377 4:17676223-17676245 TTGTGTTTCAGCGAATAGGGAGG + Intronic
970884623 4:20973754-20973776 TTGTGTTTCAGGGAATAGGCCGG + Intronic
971164205 4:24165830-24165852 GTGTGTCTCAGGGAATAGGGAGG - Intergenic
971295458 4:25385819-25385841 TTGTGTCTCAAGGAATAGGGAGG + Intronic
971609705 4:28707543-28707565 TTGTGTCTCATGGAATAGGGAGG - Intergenic
971644031 4:29173151-29173173 CTGTGTCTTGGGGAATAGGGAGG - Intergenic
971868562 4:32205743-32205765 TTGTGTCTCAAGGAATACGGAGG - Intergenic
971918235 4:32903573-32903595 TTTTGTCCCAAGGAATAGGGAGG + Intergenic
971921298 4:32943076-32943098 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
972281732 4:37608159-37608181 TTTTGTCTCAGGGAATAGGGAGG - Intronic
972383707 4:38543316-38543338 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
972560320 4:40221672-40221694 TTGTGTCTCAGAGAATAGGGAGG - Intronic
972747613 4:41953669-41953691 TTGTGTCTCAAAGAATAGGTAGG + Intronic
972768958 4:42178195-42178217 CTGTGTCTCAGGGAGTAGGGAGG + Intergenic
972776224 4:42243430-42243452 TTGTATCTCAAGGAATAGAGAGG - Intergenic
972776867 4:42249652-42249674 GTCTGTTTCAAGAATTAGGGTGG + Intergenic
973055125 4:45647536-45647558 GTGTGTCTCAAGGAATAAGGAGG + Intergenic
973165176 4:47068551-47068573 TTGTGTCTCAAAGAATAGGAAGG + Intronic
973729341 4:53808748-53808770 CTGTCTTTCATGGAATAGAAGGG - Intronic
974346515 4:60689356-60689378 CTGAGTCTCAGGGAATAGGGAGG - Intergenic
974560945 4:63517226-63517248 TTGTGTCTTCAGGAATAGGGAGG - Intergenic
974564103 4:63561735-63561757 GTGTGTTTCAGGGAGTAAGGAGG - Intergenic
974656250 4:64826477-64826499 TTGTGTCTCAAGGAACAAGGAGG + Intergenic
974816944 4:67017229-67017251 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
974980402 4:68949326-68949348 CTGTGTCTCAGGGAATAGGGAGG + Intronic
975124908 4:70770936-70770958 TTGTGTCTTAGGGAATAGGGAGG + Intronic
975133753 4:70853838-70853860 CTGTGTTGCAGGAAATAAGGAGG - Intergenic
975409213 4:74029143-74029165 CTGTGTCTCAGGGAATAGAGAGG + Intergenic
975475514 4:74818935-74818957 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
975567908 4:75779224-75779246 TTATGTCTCAGGGAATAGGGAGG - Intronic
975686546 4:76921491-76921513 TTGTATCTCAGGGAATAGGGAGG + Intergenic
976058539 4:81098629-81098651 TTGTGTCTCAGGAAATAGGGAGG + Intronic
976255923 4:83100664-83100686 TTGTGTCTCAGGGAATAGAGAGG - Intronic
976415331 4:84767354-84767376 TTGTGACTCAGGGAATAGGGAGG - Intronic
976934616 4:90614287-90614309 TTGTGTCTTAGGGAATAGGGAGG - Intronic
977003879 4:91541158-91541180 CTATGTTTCATAGAATAGGAAGG - Intronic
977158327 4:93602686-93602708 CTATGTCTCAGGGATTAGGGAGG - Intronic
977194445 4:94042149-94042171 TTGTGTCTCAGGGAATATGGAGG + Intergenic
977539340 4:98297702-98297724 TTGTGTCTCATGCAATAGGGAGG - Intronic
977568071 4:98601923-98601945 TTGTGTCTCAGGGAATACGGAGG + Intronic
977597063 4:98894967-98894989 TTGTGTCTCAGGGAATAGGCAGG + Intronic
977612888 4:99054770-99054792 TTGTGTTTCAGGGAATAGGGAGG + Intronic
977852852 4:101850931-101850953 TTTTGTCTCAGGGAATAGGGAGG - Intronic
977887137 4:102265264-102265286 TTGGGTGTCAAGGAATAGGGAGG + Intronic
977889200 4:102288401-102288423 TTGTGTCTCAGGGAATAGAGAGG - Intronic
978018713 4:103781929-103781951 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
978123043 4:105104446-105104468 TTGTGTTTCAGGGAATAGGGAGG + Intergenic
978134417 4:105239930-105239952 TTGTGTTTTAGGGAATAGAGAGG + Intronic
978204148 4:106059615-106059637 TTGTGTCTCAGGAAATAGGGAGG - Intronic
978304143 4:107303785-107303807 CTGTGTTTCAGGGAAAAGAGAGG + Intergenic
978530165 4:109704116-109704138 TTGTGTTTCCAGGAATAGGGAGG - Intergenic
978686310 4:111448487-111448509 TTGTATTTAAAGGAATAGGGAGG + Intergenic
978872587 4:113597879-113597901 TTGTGTCTCAGGGAATAGGAAGG + Intronic
979123695 4:116937694-116937716 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
979243015 4:118465813-118465835 CTGTGTTTTCAGTAAAAGGGTGG - Intergenic
979307732 4:119166957-119166979 TTGTGTCTCAGGGAATAGGGAGG - Intronic
979345631 4:119583687-119583709 TTGTCTCTCAGGGAATAGGGAGG + Intronic
979448834 4:120844642-120844664 TTGTGTCTCAGGGAATAGGGAGG - Intronic
979619308 4:122780700-122780722 TTGTGTCTCAAGGGATAGAGAGG + Intergenic
979648638 4:123104394-123104416 TTGTGTCTCAGGGAGTAGGGAGG - Intronic
979694889 4:123602129-123602151 GTGTGTCTGACGGAATAGGGAGG - Intergenic
979729447 4:124006369-124006391 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
979744467 4:124194038-124194060 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
979846240 4:125516188-125516210 TTGTGTCACAGGGAATAGGGAGG + Intergenic
979895647 4:126153154-126153176 TTGTGTCACAGGGAATAGGGAGG - Intergenic
980298990 4:130963868-130963890 CTGTGTCTCAGAGAACAGGGAGG - Intergenic
980594749 4:134939267-134939289 TTGTGTCTCAGGGAAGAGGGAGG - Intergenic
980654943 4:135769514-135769536 CTGTGTCTCAGGGAGTAGGAAGG + Intergenic
980760001 4:137220379-137220401 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
980952873 4:139398978-139399000 TTGTGTCTCAGGGAATAAGGAGG + Intronic
981220855 4:142232577-142232599 TTGTGTTTCATGGGATAGTGAGG - Intronic
981439348 4:144765431-144765453 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
981458906 4:144989527-144989549 TTGGGTCTCAGGGAATAGGGAGG - Intronic
981628675 4:146791542-146791564 TTGTGTCTCAGGGAATAGGGAGG - Intronic
981683445 4:147426555-147426577 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
981806645 4:148723718-148723740 TTGTGTCTCAAGGAATAGGGAGG + Intergenic
982085113 4:151827254-151827276 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
982300429 4:153873074-153873096 CTGTGTCTCAGGGAATAGGGAGG - Intergenic
982458872 4:155643094-155643116 TTGTGTTTCAGGGAATAGGGAGG - Intergenic
982681697 4:158438795-158438817 TTGTGTCTTAGGGAATAGGGAGG - Intronic
982946086 4:161625564-161625586 TTGTGTCTTAGGGAATAGGGAGG - Intronic
983073753 4:163299917-163299939 CTGCATCTCAGGGAATAGGGAGG + Intergenic
983275930 4:165617381-165617403 CTGTGTCTCGGGCAATAGGGAGG - Intergenic
983290239 4:165793568-165793590 TTGTGTCTCAAGGAATAGGGAGG + Intergenic
983464732 4:168073253-168073275 TTGTGTCTCAGTGAATAGGGAGG + Intergenic
983701994 4:170608409-170608431 TTGTATCTCAGGGAATAGGGAGG + Intergenic
983808606 4:172027543-172027565 GTTGGTCTCAAGGAATAGGGAGG - Intronic
983963248 4:173779419-173779441 CTGTGTATCAGGGAATAGGGAGG - Intergenic
984068101 4:175075097-175075119 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
984899131 4:184569167-184569189 TTGAGTCTCAAGAAATAGGGAGG + Intergenic
985188338 4:187343036-187343058 TTCTGTTTCAGGGAATAGGGAGG + Intergenic
985481743 5:116171-116193 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
985900442 5:2784983-2785005 CTGTGATTCAGAGAATAGGGAGG - Intergenic
986738647 5:10686235-10686257 CTATGTCTCAGGGAATAGGGAGG - Intronic
986857571 5:11888681-11888703 CTGTGTTGCAAGTAGTAGGTAGG - Intronic
987501929 5:18722688-18722710 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
987529379 5:19097654-19097676 TTGTGTCTCAGGGACTAGGGTGG - Intergenic
987626222 5:20404511-20404533 CTGTGTCTCAGGGCATAAGGAGG + Intronic
987726664 5:21709427-21709449 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
988669763 5:33368813-33368835 CTGTCTCTCAAGGAATAGGGAGG + Intergenic
988889099 5:35595167-35595189 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
989128582 5:38081029-38081051 TTGTGCCTCAGGGAATAGGGAGG - Intergenic
989303481 5:39923011-39923033 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
989324672 5:40178182-40178204 TTTTGTCTCAGGGAATAGGGAGG + Intergenic
989634236 5:43517170-43517192 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
990003024 5:50917220-50917242 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
990068145 5:51744296-51744318 TTGTGTCTCAATGAATAAGGAGG + Intergenic
990481586 5:56216340-56216362 TTGTGTCTCAAGGAATAAGGAGG - Intronic
990571880 5:57087204-57087226 TTGTGTCTCAGAGAATAGGGAGG - Intergenic
990677041 5:58198733-58198755 TTGTGTATCAGGGAATAGGGAGG + Intergenic
990779664 5:59345585-59345607 CTGTTTTTCCAGGAATAGTGTGG - Intronic
990824928 5:59888292-59888314 CTGTGTTTCATGGAAATGGGAGG - Intronic
990835931 5:60020088-60020110 TTGTGTCTCAGAGAATAGGGAGG + Intronic
991171603 5:63633039-63633061 CCATGTTTCAGGAAATAGGGAGG + Intergenic
991336232 5:65550397-65550419 TTGTGTTTTAAGGAAAAGGGAGG + Intronic
991428334 5:66515653-66515675 TTGTATCTCAGGGAATAGGGAGG + Intergenic
991651376 5:68858367-68858389 GTGTATCTCAAGGAATAAGGAGG + Intergenic
992074562 5:73179061-73179083 TTGTGTCTCAAGGAATAGGAAGG - Intergenic
992134620 5:73731582-73731604 TTGTTTTTGAAGGGATAGGGTGG + Intronic
992216719 5:74532005-74532027 TTCTGTGTCAAGGAGTAGGGAGG - Intergenic
992510578 5:77429776-77429798 TTGTGTCTCAGGGAATAGGGAGG - Exonic
992835953 5:80641596-80641618 TTGTGTCTCAGGGAATTGGGAGG - Intronic
993033456 5:82730811-82730833 TTGTGTTTCCAGGGAGAGGGGGG - Intergenic
993082133 5:83314849-83314871 TTGTGGGTCAGGGAATAGGGAGG - Intronic
993275974 5:85859281-85859303 ATGTGTCTCAGGGAATAGAGAGG + Intergenic
993368754 5:87065425-87065447 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
993400456 5:87443475-87443497 GTGTGTCTCAGGGAATAGGGAGG + Intergenic
993709397 5:91209230-91209252 TTGTGTCTCAGGGAAGAGGGAGG + Intergenic
993712919 5:91245765-91245787 CTGTGTTTTAGGGAATAAGGCGG + Intergenic
993734201 5:91456792-91456814 ATGTTTTTCAGGGGATAGGGAGG - Intergenic
993897863 5:93559685-93559707 TTGTGTCTCAGGGAATAGGGTGG + Intergenic
993906447 5:93629138-93629160 TTGTGTCTCAAGGAATAGGGAGG + Intronic
993918811 5:93774222-93774244 CTGTGTTTCAAGGAACAGGGAGG - Intronic
994020052 5:95012793-95012815 TTGTGTCTCAGGTAATAGGGAGG - Intronic
994736767 5:103565551-103565573 CTGTATCTCAGGGAATAGGGAGG - Intergenic
994900729 5:105765306-105765328 TTGTGTCTCCAGGAATATGGTGG + Intergenic
995052090 5:107718695-107718717 CAGTGATTCAAGGGATAGGAGGG + Intergenic
995214386 5:109578473-109578495 TTGTGTCTTAGGGAATAGGGAGG + Intergenic
995431249 5:112080339-112080361 CTGTGTCTCAGAGAATAGGGAGG - Intergenic
995579617 5:113582691-113582713 CTGTTTTTCAAGGATCAGGTGGG + Intronic
996067321 5:119093527-119093549 TTGTGTCTCAGTGAATAGGGAGG - Intronic
996209838 5:120794629-120794651 TTGTGTCTTAGGGAATAGGGAGG - Intergenic
996351965 5:122553864-122553886 TTGTATGTCAGGGAATAGGGAGG - Intergenic
996464896 5:123788781-123788803 TTGTGACTCAGGGAATAGGGTGG - Intergenic
996526384 5:124484568-124484590 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
996586625 5:125095477-125095499 TTGTGTCTCAGGGAATAAGGAGG - Intergenic
996807444 5:127472604-127472626 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
997162918 5:131628031-131628053 TTATGTCTCAGGGAATAGGGAGG - Intronic
997176214 5:131780786-131780808 GTATGTCTCAGGGAATAGGGAGG - Intronic
997483936 5:134212507-134212529 TTGTGTCTCAGGGGATAGGGAGG - Intronic
997727927 5:136137638-136137660 GTGTGTTCCCAGGAAGAGGGGGG + Intronic
998510303 5:142707740-142707762 TTGTGTCTCAGGGAATAAGGAGG - Intergenic
998615261 5:143733554-143733576 CTGTATTTCCAGGCATATGGTGG - Intergenic
998814541 5:145999604-145999626 TTGTGTCTCAGAGAATAGGGAGG + Intronic
999039267 5:148389043-148389065 TTGTGTCTCAGGAAATAGGGAGG + Intronic
999514918 5:152291441-152291463 TTGTGTCTCAGAGAATAGGGGGG - Intergenic
999801201 5:155038768-155038790 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1000026509 5:157363546-157363568 CTTGGTCTTAAGGAATAGGGAGG + Intronic
1000389256 5:160705985-160706007 CTGTGTCTCAGGGAATAAGGAGG + Intronic
1000453807 5:161423651-161423673 TTGTGTCTCAGGGAATAGGAAGG - Intronic
1000492609 5:161933361-161933383 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1000886691 5:166755765-166755787 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1001344595 5:170881366-170881388 ATGGGTTTCAAGGAACACGGAGG + Intronic
1001479759 5:172080275-172080297 TTGTGTCTCAGAGAATAGGGAGG - Intronic
1001526172 5:172430371-172430393 CTGTGTTCCCAGGACTATGGGGG - Intronic
1002881731 6:1258370-1258392 TTGTGTTTCAGGGAAGAGGGAGG - Intergenic
1003473182 6:6456307-6456329 CTGTGTCTCAAGGAATAGAGAGG - Intergenic
1003598763 6:7499341-7499363 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1003830940 6:10010752-10010774 TTGTGTCTCAAGGAATAAAGAGG + Intronic
1004152838 6:13136747-13136769 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1004857178 6:19763140-19763162 TTGTGTCTCAGGAAATAGGGAGG - Intergenic
1004913165 6:20306513-20306535 CTGTGTCTCAAGGAATGGACAGG + Intergenic
1004926686 6:20422675-20422697 TTGTTTCTTAAGGAATAGGGAGG + Intronic
1005213981 6:23503496-23503518 CTGTGTCTCAGAAAATAGGGAGG + Intergenic
1005703301 6:28426382-28426404 GTGTGTCTCAGGGAATAGGGAGG + Intergenic
1006075065 6:31527118-31527140 TTGTGCCTCAGGGAATAGGGAGG + Intergenic
1006325024 6:33347114-33347136 CTGTGTTTTAAGGAATGGAAAGG - Intergenic
1006645966 6:35514261-35514283 ATAGGTTTCATGGAATAGGGAGG - Intergenic
1006875672 6:37293561-37293583 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1007023630 6:38547133-38547155 TCATGTTTCAGGGAATAGGGAGG - Intronic
1007379582 6:41479316-41479338 TTTTGTCTCAGGGAATAGGGAGG - Intergenic
1007547785 6:42707578-42707600 CTGTTTTTCAAAGATTAGGTTGG - Intronic
1007650909 6:43421035-43421057 GTGTGTGTCAGGGAATAAGGAGG - Intergenic
1007685281 6:43663555-43663577 TTGTGTCTCAGGGAATAGGGTGG + Intronic
1007863824 6:44945253-44945275 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1008087927 6:47263600-47263622 AAGTGTTTCAAGGAAAAGGGAGG + Intronic
1008197684 6:48544674-48544696 ATGTGTCTCAAGGACTAGGGAGG + Intergenic
1008255040 6:49288016-49288038 TTGTGTCTCAGAGAATAGGGAGG + Intergenic
1008268907 6:49466092-49466114 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1008271069 6:49490756-49490778 TTGTGTCACAGGGAATAGGGAGG + Intronic
1008812545 6:55521726-55521748 TTGTGTCTCAGGGAATGGGGAGG - Intronic
1008916838 6:56797298-56797320 TTGTGTTTCAGGGAATAAGGGGG - Intronic
1009175415 6:60454541-60454563 TTGTGTTTCTGGGAATAGAGAGG + Intergenic
1009627317 6:66151870-66151892 TTGTATCTCAGGGAATAGGGAGG - Intergenic
1010895731 6:81360472-81360494 CTCTGTTTTAGGGAATAAGGAGG + Intergenic
1011060684 6:83263252-83263274 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1011095968 6:83663183-83663205 TTGTGTCTCAGGGAATAAGGAGG - Intronic
1011178661 6:84593649-84593671 TTGTGTGTCATGGAATAGAGAGG + Intergenic
1011218035 6:85026116-85026138 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1011561632 6:88623441-88623463 CTCTGTCACAAGGAATTGGGTGG - Intronic
1011587879 6:88946395-88946417 TTGTGTCTCAGGAAATAGGGAGG - Intronic
1011737357 6:90325022-90325044 TTGTGTCTCAGGGAATAAGGAGG + Intergenic
1012109058 6:95203233-95203255 TTGTGTCTCACGGAATAAGGAGG + Intergenic
1012304540 6:97636551-97636573 TTGTGTCTCAGAGAATAGGGAGG - Intergenic
1012340065 6:98109854-98109876 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1012365854 6:98439161-98439183 TTGTGTCTCAAGAAATAGTGAGG + Intergenic
1012472345 6:99586519-99586541 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
1012930983 6:105316272-105316294 TTATGTCTCAGGGAATAGGGCGG + Intronic
1013030867 6:106331385-106331407 TAGTGTCTCAGGGAATAGGGAGG - Intergenic
1013088815 6:106880441-106880463 TTGTGTCTCAGGGAAGAGGGAGG + Intergenic
1013202745 6:107916865-107916887 GTGTGTCTCAGGGAATAGGGAGG - Intronic
1013266463 6:108504362-108504384 TTGTATCTCAGGGAATAGGGAGG + Intronic
1013814450 6:114081043-114081065 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1014034884 6:116755014-116755036 TTGCATCTCAAGGAATAGGGAGG - Intronic
1014478035 6:121899247-121899269 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1014509006 6:122297351-122297373 TTGTGTCTCAAGGAATAGGAAGG + Intergenic
1014705045 6:124735862-124735884 TTGTGTATGAAAGAATAGGGAGG - Intronic
1015305726 6:131705070-131705092 TTGTGTCTCAGGGACTAGGGAGG + Intronic
1015648285 6:135421019-135421041 CTGTGTCTCAGAGAATAGGGAGG + Intronic
1016220358 6:141661681-141661703 TGCTGTTTCAGGGAATAGGGAGG + Intergenic
1016409265 6:143764812-143764834 CTGTCTTTCTAGGAATAGAGTGG - Intronic
1016429921 6:143972837-143972859 CTGTGTTTAAAAAAAGAGGGCGG + Intronic
1016490853 6:144600151-144600173 TTATGTCTCAGGGAATAGGGAGG - Intronic
1016571965 6:145523661-145523683 TTGTGTTTCAGGGAATAGGAAGG - Intronic
1016579514 6:145614628-145614650 TTGTGTCTTAAGGAATAGGGAGG + Intronic
1016608911 6:145965676-145965698 TTGTGTCTCAAAGAATAGGGAGG - Intergenic
1016867395 6:148780995-148781017 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1017059234 6:150465934-150465956 CTGGGGTTCAAGGAATGGGGAGG - Intergenic
1017068834 6:150554145-150554167 TTATGTCTCAGGGAATAGGGAGG - Intergenic
1017184157 6:151583827-151583849 TTGTGTCTCAGGAAATAGGGAGG + Intronic
1017799574 6:157881373-157881395 TTGTGTCTCAGAGAATAGGGAGG - Intronic
1018101269 6:160442749-160442771 CTGTGTTTGCAGGAATAGCATGG + Exonic
1018389158 6:163329684-163329706 CTGCTTTTCTGGGAATAGGGGGG - Intergenic
1018599212 6:165521269-165521291 TTGTGTCTCAGGGAATAAGGAGG - Intronic
1019263545 7:97581-97603 TTGTGTCTCAGGTAATAGGGAGG + Intergenic
1020090882 7:5339964-5339986 TTGTGCTTTAGGGAATAGGGAGG - Intronic
1020570675 7:9857069-9857091 TTGTATCTCAAGGAATAGGGAGG + Intergenic
1020765054 7:12308938-12308960 CTGTGTCTCAGGGAAGAGGGAGG + Intergenic
1020939410 7:14511820-14511842 TTGTGTCTCAGGGAACAGGGAGG + Intronic
1021015575 7:15527032-15527054 CTGTGTCTCAGGGAACAGGGAGG - Intronic
1021016036 7:15535310-15535332 CTATTTTTCTAGGAATGGGGGGG + Intronic
1021737428 7:23653572-23653594 CTGTGTGTCAAGAAACAGGATGG + Intergenic
1021974781 7:26001105-26001127 TTGTTTCTCAAGAAATAGGGAGG + Intergenic
1022066708 7:26865804-26865826 TTGTGTCTCAAGGAATGGGGAGG - Intronic
1022144982 7:27528211-27528233 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1022951380 7:35341473-35341495 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1022958854 7:35405941-35405963 TTGTGTCTCAGGAAATAGGGAGG - Intergenic
1023099972 7:36707226-36707248 TTTTGTCTCAGGGAATAGGGAGG + Intronic
1023645291 7:42306367-42306389 TTGTGTATCAGGCAATAGGGAGG - Intergenic
1023710260 7:42985197-42985219 TTGTGTCTCAGAGAATAGGGAGG + Intergenic
1023711670 7:43000059-43000081 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1023724367 7:43126954-43126976 TTGTGTCTCAGGGAATAGGGTGG - Intronic
1023773245 7:43579265-43579287 TTGTGTTTCAGAGAATAGGGAGG + Intergenic
1023778455 7:43633385-43633407 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1024257961 7:47552705-47552727 TTGTGTCTCAGGGAATATGGAGG - Intronic
1024837895 7:53545414-53545436 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1026069234 7:67102998-67103020 CTGTGCTTCAGGGAATAAGCAGG + Intronic
1026258492 7:68733730-68733752 CTGTTTGGCAAGGAATTGGGAGG - Intergenic
1026415342 7:70173893-70173915 TTGTGTCTCAGGGAATAGGAAGG - Intronic
1027503870 7:78990408-78990430 CTACGTTTCAGGGAATTGGGTGG - Intronic
1027596052 7:80175845-80175867 CTGTGTCTCAGGAAATAGGGAGG - Intronic
1027917644 7:84346543-84346565 TTGTGTCTCAGGGAATAAGGAGG + Intronic
1028049493 7:86164126-86164148 CTGTGTTCCAGGGAACAGGAAGG + Intergenic
1028300101 7:89188392-89188414 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1028372355 7:90107599-90107621 TTGTGTCTCAGGGAATAGGATGG + Intergenic
1028408614 7:90503605-90503627 CTGTGTCTCACTGAAGAGGGAGG + Intronic
1029980958 7:104878575-104878597 TTGTATCTCATGGAATAGGGAGG - Intronic
1029996859 7:105014589-105014611 TTGTGTTTCAAGGGGGAGGGAGG + Intronic
1030172922 7:106622774-106622796 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1030483695 7:110138450-110138472 CTGTGTATCAGCGAATAAGGAGG - Intergenic
1030664864 7:112265321-112265343 TTGTGTCTCAGGGAATTGGGAGG + Intronic
1030975695 7:116120200-116120222 CTGTGTTTCAGGGAAGAAGATGG + Intronic
1031498740 7:122485117-122485139 TTGTGTGTCAGGAAATAGGGAGG - Intronic
1031511329 7:122653903-122653925 GTGTGTTTTAGGGAATAGGCAGG - Intronic
1031716114 7:125110528-125110550 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1031860221 7:126970868-126970890 TTGTGTCTCAGGGCATAGGGAGG + Intronic
1032180882 7:129676464-129676486 CTGTGTCTCAGGGAACAGGAAGG + Intronic
1032235514 7:130118763-130118785 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1032701607 7:134385204-134385226 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1032769039 7:135029863-135029885 TTATGTCTCAGGGAATAGGGAGG + Intronic
1032840244 7:135707772-135707794 CTGTGTATCAGGGAACAGGCTGG - Intronic
1033140881 7:138825319-138825341 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1033493786 7:141872372-141872394 TTGTGTTTCAAGAATTTGGGGGG + Intergenic
1033739840 7:144263301-144263323 TTGTGTCTCAGGGACTAGGGAGG + Intergenic
1034743299 7:153498247-153498269 TTGTGTCTCAGGGAACAGGGAGG - Intergenic
1034873243 7:154702229-154702251 TTGTGTGTCAAGGAATAGGGAGG - Intronic
1034981130 7:155477624-155477646 TTGTGTCTCAGGGAATGGGGAGG - Intronic
1035144406 7:156799581-156799603 TTGTGTCTCAGGGAATGGGGAGG - Intronic
1035183600 7:157108666-157108688 CTGTGTTCCAAGGAATGGCCAGG + Intergenic
1035387087 7:158480418-158480440 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1035720502 8:1787913-1787935 CTGTATTTCAAGGAAAAAGGAGG - Intergenic
1035943806 8:3935735-3935757 CTGTGTCTCACGGAATAGCGAGG - Intronic
1036039821 8:5063906-5063928 CTGTGTCTCAGGGAACAGAGAGG - Intergenic
1036108070 8:5863642-5863664 CTGTGTCTCAGGGACTAGGGAGG + Intergenic
1036469116 8:9034641-9034663 TTGTGTCTCAGGGAATAGGTAGG - Intronic
1036478182 8:9113371-9113393 TTATGTCTCAGGGAATAGGGAGG + Intronic
1037122443 8:15304947-15304969 CTGTGTTTGCAGGTAGAGGGTGG + Intergenic
1037143752 8:15548881-15548903 CTGAGATTCAAGGATCAGGGAGG - Intronic
1037218543 8:16487926-16487948 GTGTGTGTCAGGGAATAGGGAGG + Intronic
1037303726 8:17482446-17482468 TTGTATATCAGGGAATAGGGAGG - Intergenic
1037428675 8:18785808-18785830 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1037435616 8:18860129-18860151 GTGTGTCTCAGGCAATAGGGAGG + Intronic
1038025651 8:23587236-23587258 TTATGTCTCAGGGAATAGGGAGG + Intergenic
1038130301 8:24723272-24723294 GTGTGTCTCAGAGAATAGGGAGG - Intergenic
1038894101 8:31761567-31761589 TTTTGTCTCAGGGAATAGGGAGG + Intronic
1038904323 8:31881445-31881467 TTTTGTCTCAAGGAATAGGGAGG - Intronic
1039132517 8:34283365-34283387 CTGATTTTCTAGGAAGAGGGTGG + Intergenic
1039192306 8:34990506-34990528 CCGTGTTTCAGGGAATGGAGAGG - Intergenic
1039603428 8:38861477-38861499 TTGTGTCTCAAGGAATAGGGAGG - Intergenic
1040033771 8:42849244-42849266 TTGTGTCTCAGGCAATAGGGAGG + Intergenic
1040058082 8:43078641-43078663 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1040076067 8:43232386-43232408 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1040441271 8:47445462-47445484 TTGTGTCTCATGGAATAGGGAGG - Intronic
1040459794 8:47636337-47636359 TTGTGTTTCAGGGAATAGGGAGG - Intronic
1040774116 8:51018366-51018388 TTGTGTGTCAGGGAATAGGAAGG + Intergenic
1041055405 8:53980682-53980704 TTGTGTCTCAGGGAGTAGGGAGG - Intronic
1041404072 8:57478145-57478167 TTGTGTTTCAGAGAATAGGGGGG - Intergenic
1041432307 8:57796415-57796437 TTGTGTCTCAAGGAATAGGGAGG - Intergenic
1041770048 8:61463570-61463592 TTGTGTCTCAAGGAATAGCGAGG + Intronic
1041926254 8:63240078-63240100 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1042045539 8:64647111-64647133 TTGTGTCTCAGGGAATGGGGAGG + Intronic
1042419418 8:68568004-68568026 CTGTGTCTCAGGGAATAGGGAGG + Intronic
1042686742 8:71450376-71450398 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1042785799 8:72545598-72545620 TTGTGTCTCAGGGAACAGGGAGG - Intronic
1042882408 8:73508335-73508357 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1043275722 8:78389755-78389777 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1043601319 8:81941873-81941895 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1043646089 8:82520615-82520637 CTGTGTTTCACAAATTAGGGTGG + Intergenic
1043722480 8:83562991-83563013 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1043737011 8:83761243-83761265 ATGTGTTTGAAGGGATAGGAAGG - Intergenic
1043990878 8:86752559-86752581 TTGCGTCTCAGGGAATAGGGAGG + Intergenic
1044223148 8:89693146-89693168 TTGTGTTTCAGAGAATAGGGAGG - Intergenic
1044414437 8:91920189-91920211 TTGTGTTTCAGGGAATAGGGAGG - Intergenic
1044461204 8:92446460-92446482 TTGTGCCTCAAAGAATAGGGAGG - Intergenic
1044616157 8:94144156-94144178 TTGTGTCTCAGGCAATAGGGAGG + Intronic
1044639960 8:94368820-94368842 TTATGTCTCAGGGAATAGGGAGG - Intergenic
1044807743 8:96025503-96025525 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1045038684 8:98199476-98199498 TTGTGTCTCAGGGAATAAGGAGG + Intronic
1045232937 8:100322771-100322793 TTGTGTTTCCAAGAATAGGGAGG + Intronic
1045355435 8:101384344-101384366 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1045465601 8:102466847-102466869 CTTTGTCTCAGTGAATAGGGAGG + Intergenic
1045541940 8:103094875-103094897 TTGTGCCTCAGGGAATAGGGAGG + Intergenic
1045670263 8:104543514-104543536 TTGTGTCTCAGGGAAGAGGGAGG - Intronic
1046241890 8:111507147-111507169 CTCTGCTTCAGGGGATAGGGTGG + Intergenic
1046316787 8:112513367-112513389 CTGTGTATCAGAGAATAGGTAGG + Intronic
1046545511 8:115644830-115644852 TTATGTCTCAGGGAATAGGGAGG + Intronic
1046569323 8:115942985-115943007 CTGTGTTTCTTGGAATACAGAGG + Intergenic
1046652997 8:116859690-116859712 TTGTGTCTCAAGGAACAGGGAGG - Intronic
1046754929 8:117963105-117963127 CTGTGTTCCAGGGAACAGGAAGG - Intronic
1047147697 8:122223321-122223343 GTGTGTCTCAGGAAATAGGGAGG + Intergenic
1047576950 8:126166614-126166636 CTATGTATCAGGGAATAGGGAGG + Intergenic
1047663943 8:127069110-127069132 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1047888798 8:129283475-129283497 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1048046264 8:130776017-130776039 TTGTGTCTCAGGAAATAGGGAGG + Intergenic
1048079452 8:131109588-131109610 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1048084429 8:131161631-131161653 CTGTGGTTTAAGGAACAGTGTGG - Intergenic
1048433389 8:134391500-134391522 TTGTATCTCAGGGAATAGGGAGG - Intergenic
1048604954 8:135957972-135957994 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1048824331 8:138409220-138409242 TTGTGTCTCCAGGATTAGGGAGG + Intronic
1048902474 8:139051971-139051993 TTGTGTCTCAGAGAATAGGGAGG - Intergenic
1049126194 8:140791178-140791200 CTGTGTTTTAAGAAATGGGGTGG + Intronic
1049834775 8:144728177-144728199 CTGAGTCTCAGGGAATATGGAGG + Intronic
1050380951 9:5029207-5029229 TTGTGTCTCAGGGAATAGAGAGG + Intronic
1050383785 9:5061933-5061955 TTGTGTCTGAGGGAATAGGGAGG + Intronic
1050454082 9:5816117-5816139 CTCTGTCTCATGGAAGAGGGTGG - Intronic
1050647643 9:7738698-7738720 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1050649737 9:7763131-7763153 TTGTGTTTCAGGGGATAGGAAGG - Intergenic
1050699466 9:8322168-8322190 TTGTGTCTCAAGGAATAGGGAGG - Intronic
1050755475 9:8997585-8997607 TTGTGTTTCAGCGAACAGGGAGG - Intronic
1051298248 9:15619124-15619146 TTGTGTCTCAAGGAGTAGGAAGG - Intronic
1051613576 9:18985093-18985115 CTGTGTCTCAATGAATAGGGAGG + Intronic
1051797606 9:20891227-20891249 TTGTGTCTCAGAGAATAGGGAGG - Intronic
1051853000 9:21530638-21530660 TTGTGTGTCAAAGAATAGGGAGG + Intergenic
1051967936 9:22851773-22851795 CTGTATCTCAGGGAATAGGGAGG + Intergenic
1052060487 9:23954554-23954576 TTGTGTCTCAAGGAATAGAAAGG - Intergenic
1052423787 9:28277396-28277418 TTGTGTCTCAGGGAATAGGGAGG - Intronic
1052543293 9:29838855-29838877 TTGTGTCTCAAAGAATAGGGAGG + Intergenic
1052560802 9:30080436-30080458 CAGTGTTTCAAGAAATAGGCTGG + Intergenic
1053113759 9:35484326-35484348 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1053217757 9:36286831-36286853 TTGTGTCTCAGGGAGTAGGGAGG + Intronic
1053296481 9:36918057-36918079 ATGTCTCTCAGGGAATAGGGAGG - Intronic
1053465626 9:38306049-38306071 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1055542714 9:77329488-77329510 TTGTGTTTCAGAGAATAGGGAGG + Intronic
1055557172 9:77486693-77486715 CTGTGTTTCAGGTAATAGGGAGG + Intronic
1055904871 9:81281535-81281557 GTGTTTTTAAAGGAATAGTGAGG - Intergenic
1056093786 9:83230722-83230744 CTGTATCTCAGGGAATAGGGAGG + Intergenic
1057240266 9:93401583-93401605 TTGTGTCTGAAGGAACAGGGAGG - Intergenic
1057538994 9:95946981-95947003 CTGTGTCTCAGGGAAGAGGGAGG - Intronic
1057603081 9:96476105-96476127 CTGAGATTCAGGGAATAAGGGGG - Intronic
1057955212 9:99401802-99401824 CTGTGTTCCATGGAATGGGCCGG + Intergenic
1058223634 9:102333464-102333486 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1058638799 9:107063195-107063217 TTGTGTCTAAGGGAATAGGGAGG + Intergenic
1058928021 9:109687925-109687947 CTGTGTCTCAGGAAATAGAGAGG + Intronic
1059156620 9:111995081-111995103 TTGTGTCTCAGGGAATAGAGAGG + Intergenic
1060460438 9:123848530-123848552 TTGTGTCTCAAGGAATAAGGAGG - Intronic
1060843950 9:126819604-126819626 TTGTGTATCACGTAATAGGGAGG - Intronic
1186199365 X:7141059-7141081 GTGTGATTCAGGGACTAGGGAGG - Intronic
1186256011 X:7720660-7720682 CTGTGTCTCAGGGAATAGGGAGG + Intergenic
1186395293 X:9202217-9202239 TTGTGTCTCAGGAAATAGGGAGG - Intergenic
1186510056 X:10124116-10124138 ATGTGTCTGAAGGAACAGGGCGG - Intronic
1186535746 X:10346112-10346134 TTGTGTCTCAGGTAATAGGGAGG - Intergenic
1186942337 X:14523661-14523683 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1187449191 X:19381757-19381779 CTGAGTTTCAAGGAAAACGAAGG - Intronic
1187516618 X:19977131-19977153 TTGTGTCTCAGGGAGTAGGGAGG - Intergenic
1188583329 X:31742465-31742487 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1188874501 X:35413447-35413469 CAATATTTCAAGGAAAAGGGAGG - Intergenic
1189788016 X:44577071-44577093 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1189923090 X:45922735-45922757 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1189951618 X:46237740-46237762 TTGTGTCTCAAGAAATATGGAGG - Intergenic
1190141925 X:47854615-47854637 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1190177565 X:48164039-48164061 CTGTGTGTCAGGAAATAGGGAGG + Intergenic
1190183600 X:48216034-48216056 CTGTGTCTCAGGAAATAGGGAGG + Intronic
1190189505 X:48265437-48265459 CTGTATCTCAGGGAATAGGTAGG + Intronic
1190193656 X:48298082-48298104 CTGTGTCTCAGGAAATAGGGAGG - Intergenic
1190196681 X:48325730-48325752 CTGTGTCTCAAGAAATAGGGAGG + Intergenic
1190199528 X:48348437-48348459 CTGTGTCTCAGGAAATAGGGAGG - Intronic
1190204370 X:48391014-48391036 CTGTGTCTCAGGAAATAGGGAGG + Intronic
1190206166 X:48404389-48404411 CTGTGTCTCAGGAAATAGGGAGG - Intronic
1190210208 X:48440664-48440686 CTGTGTCTCAGGAAATAGGGAGG + Intergenic
1190327163 X:49213694-49213716 CTGAGTCTCCAGGAGTAGGGAGG + Intronic
1190460815 X:50672005-50672027 TTGTGTCTCAGGGAATAGGGAGG + Intronic
1190658266 X:52631938-52631960 CTGTGTCTCAGGGAATAGGTAGG + Intergenic
1190660175 X:52646711-52646733 GTGTGTCTCAAGAAATAGGGAGG - Intronic
1190663409 X:52676101-52676123 CTGTGTCTCAAGAAATAGGGAGG + Intronic
1190666303 X:52698920-52698942 CTGTGTCTCAGGAAATAGGGAGG - Exonic
1190673115 X:52759490-52759512 CTGTGTCTCAGGAAATAGGGAGG + Exonic
1190676014 X:52782381-52782403 CTGTGTCTCAAGAAATAGGGAGG - Intronic
1191773815 X:64790627-64790649 TTGTGTTTCAGGCAATAGGAAGG - Intergenic
1191926514 X:66316884-66316906 TTGTCTTTCAAGGAATAAGGAGG + Intergenic
1192328670 X:70155981-70156003 TTGTGTCTCAAGGAACAGAGAGG + Intronic
1192720314 X:73689193-73689215 TTTTGTCTCAGGGAATAGGGAGG + Intergenic
1193685238 X:84570071-84570093 TTGTGTCTCAAGGAATGTGGAGG - Intergenic
1193971266 X:88056886-88056908 CTGTGTCTCAGGAAATAGGCAGG - Intergenic
1194100490 X:89697312-89697334 TTGTCTCTCAGGGAATAGGGAGG + Intergenic
1194759810 X:97782548-97782570 TTGTGTCTCAGGGAATAGGAAGG - Intergenic
1195231173 X:102849817-102849839 TTGTGTCCCAGGGAATAGGGAGG + Intergenic
1195338735 X:103883485-103883507 TTGTGTCTCAGGGAATAGGGAGG - Intergenic
1195511626 X:105722432-105722454 CTTTGTTTCAAGGACTTTGGAGG - Intronic
1196067315 X:111478396-111478418 CTGTTTCTCAGGGAATAGGGAGG + Intergenic
1196214587 X:113035668-113035690 CTGTCTTTCAAGTATTTGGGCGG + Intergenic
1196504777 X:116428492-116428514 TTGTGTTTCAGGAAATAGAGAGG - Intergenic
1196578029 X:117343866-117343888 TTGTGTCTCAGGGAATAGGAAGG + Intergenic
1196721361 X:118857475-118857497 TTGTATTTCAGGGAATAGGGAGG - Intergenic
1196752385 X:119129680-119129702 CTGTGTATCAAGGGAAAGAGGGG - Intronic
1197423278 X:126264618-126264640 TTGTGTCTCAGGGAATAGGGAGG + Intergenic
1197505379 X:127296210-127296232 TTCTGTTTCAGGGAATAGGAAGG + Intergenic
1197947998 X:131861589-131861611 CTGGGTTTCCAGGATTAGAGAGG + Intergenic
1198304831 X:135369918-135369940 CTGTGTCTCATGGAATAGGGTGG - Intergenic
1198323137 X:135539770-135539792 TTGTGTCTCAAGGAATAGGGAGG + Intronic
1198607009 X:138351798-138351820 TTGTGCCTCAGGGAATAGGGAGG - Intergenic
1198634586 X:138681770-138681792 TTGTGTTTCAGGGAATGGGGAGG + Intronic
1198818856 X:140623751-140623773 TTGTGTCTCAGGGAATAGAGAGG - Intergenic
1199694664 X:150335372-150335394 CTGGGTTTCAAGGAATATGATGG + Intergenic
1199932312 X:152536010-152536032 AAGTTTTTCAAGGAAGAGGGAGG + Intergenic
1200020245 X:153197879-153197901 TTGTGTCTCAGGGAGTAGGGAGG - Intergenic
1200391808 X:155952962-155952984 CTCAGTTTCAATGTATAGGGGGG + Intergenic
1200453445 Y:3358374-3358396 TTGTCTGTCAGGGAATAGGGAGG + Intergenic
1201143731 Y:11050015-11050037 TTGTGTTTTAGGGCATAGGGAGG - Intergenic
1202594141 Y:26519530-26519552 TTGTGTCTCAGGGAATAGGGAGG - Intergenic