ID: 1117589885

View in Genome Browser
Species Human (GRCh38)
Location 14:57256317-57256339
Sequence TTACAACCCTGGCCTAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117589880_1117589885 10 Left 1117589880 14:57256284-57256306 CCTCAACCAATTCTGAAAATGTA 0: 1
1: 0
2: 1
3: 26
4: 324
Right 1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1117589878_1117589885 12 Left 1117589878 14:57256282-57256304 CCCCTCAACCAATTCTGAAAATG 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1117589877_1117589885 13 Left 1117589877 14:57256281-57256303 CCCCCTCAACCAATTCTGAAAAT 0: 1
1: 0
2: 0
3: 35
4: 426
Right 1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1117589879_1117589885 11 Left 1117589879 14:57256283-57256305 CCCTCAACCAATTCTGAAAATGT 0: 1
1: 0
2: 0
3: 26
4: 262
Right 1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1117589882_1117589885 4 Left 1117589882 14:57256290-57256312 CCAATTCTGAAAATGTATGGACA 0: 1
1: 0
2: 0
3: 12
4: 207
Right 1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117589885 Original CRISPR TTACAACCCTGGCCTAAAAA GGG Intronic
901629379 1:10640852-10640874 TTACAACCCTGGCCTTGGCAGGG - Intronic
904924041 1:34031661-34031683 TTACACCCCTGGCCAAGACAGGG + Intronic
906165011 1:43679597-43679619 TTACCAGACTGACCTAAAAAAGG - Intronic
909193776 1:72589682-72589704 TTACAAGCCTGTTCTATAAATGG - Intergenic
912108025 1:106305210-106305232 TCACAAAAATGGCCTAAAAATGG - Intergenic
913051133 1:115117497-115117519 TTCCTACCATGGCCTAAAACTGG - Intergenic
914509848 1:148321838-148321860 TTCCAACCCTGGCCTATAGCTGG + Intergenic
916473176 1:165143397-165143419 TTACCACCCTGGCCCAAGCATGG - Intergenic
920762555 1:208799418-208799440 TTACAAGCCAGGCTTAAAAGTGG - Intergenic
1074073932 10:110102792-110102814 CAAAAACCCTGGCATAAAAATGG - Intronic
1076527485 10:131121324-131121346 GTACAACCTTGGCCAAAATATGG + Intronic
1077619596 11:3708688-3708710 TTTCAGGACTGGCCTAAAAAGGG - Intronic
1080874881 11:36266161-36266183 TTCCCACCCTGGCCTAAAATCGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1088680524 11:112237719-112237741 TTACTTCCCTGGCATCAAAAAGG - Intronic
1095035482 12:37363013-37363035 TTTCAACACTGCCCTAATAAAGG + Intergenic
1110493112 13:76132887-76132909 TTCTGACCCTGACCTAAAAATGG + Intergenic
1112151187 13:96766059-96766081 TTACAACCCAGGGCTACAAAAGG - Intronic
1117589885 14:57256317-57256339 TTACAACCCTGGCCTAAAAAGGG + Intronic
1118634991 14:67740128-67740150 GTACATCCCTGGCCCAGAAATGG - Intronic
1118680117 14:68232419-68232441 AAACCAACCTGGCCTAAAAAAGG + Intronic
1119850233 14:77861573-77861595 TTTCATCCCTGGCTTAAAAGAGG + Intronic
1119889399 14:78171661-78171683 TTACATCACTGGCCTAAGAAGGG - Intergenic
1126512570 15:49496563-49496585 TTACATTCCAGTCCTAAAAAGGG + Intronic
1127810310 15:62560027-62560049 TTAGATCCCTGGCCTGGAAATGG + Intronic
1131133623 15:89915915-89915937 TTCCAACACTGGCCTCAATAGGG - Intergenic
1132104864 15:99056063-99056085 TGACAAGCCTGGGCTTAAAAGGG + Intergenic
1133851783 16:9511565-9511587 TCATAAACCTGGCCTACAAAGGG + Intergenic
1137632941 16:49960199-49960221 AAACAAACCTGGCCTAAAAAAGG + Intergenic
1138135628 16:54519034-54519056 TTATAATCCAGGCCTAGAAATGG + Intergenic
1139073927 16:63419710-63419732 TGACAACTCTGGACCAAAAAGGG + Intergenic
1147272638 17:39286836-39286858 TTAAAATCCTGGAATAAAAAAGG - Intronic
1147286551 17:39407106-39407128 TTTAAAACATGGCCTAAAAATGG + Exonic
1154548550 18:15646156-15646178 TTTCAAGCCTGCCCTTAAAAAGG - Intergenic
1154770886 18:18704862-18704884 TTTCAAACCTGCTCTAAAAAAGG - Intergenic
1154909067 18:20620482-20620504 TTTCAAACCTGGTCTAAGAAAGG - Intergenic
1154915750 18:20724348-20724370 TTTCAAACCTGGTCTAAGAAAGG - Intergenic
1154916925 18:20742303-20742325 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154917217 18:20746894-20746916 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154917917 18:20757173-20757195 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154918407 18:20764659-20764681 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154918648 18:20768405-20768427 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154918768 18:20770276-20770298 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154919471 18:20781502-20781524 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154921106 18:20807188-20807210 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154921227 18:20809061-20809083 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154921640 18:20815559-20815581 TTTCAAACCTGGTCTAAGAAAGG + Intergenic
1154924610 18:20913010-20913032 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154924730 18:20914882-20914904 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1154924966 18:20918626-20918648 TTTCAACCCTGCTCTAAGAAAGG - Intergenic
1157997262 18:52572999-52573021 TAAGCACCCTGGCCTAAGAAAGG + Intronic
1158136148 18:54210575-54210597 TTAGAGCCCTGGCCTCATAATGG - Intronic
1158933033 18:62339429-62339451 TTGCAACCCTGGCCTCAGACTGG - Intronic
1159120837 18:64168280-64168302 TTTCAGTCCTGGCCTAAACATGG - Intergenic
1159393126 18:67820843-67820865 TTTCAACCATGGCATAAGAATGG + Intergenic
1162966914 19:14160447-14160469 TCACCTCCCTGGCCTACAAAGGG - Intronic
1163316946 19:16547146-16547168 TTTTAACAGTGGCCTAAAAATGG - Intronic
1164356260 19:27434884-27434906 TTTCACCACTGGCCTAAAAGCGG - Intergenic
1165924249 19:39317385-39317407 TGGAAACCCTGGCCTAGAAAGGG + Intergenic
1166504611 19:43363318-43363340 TTACCACCATAGCCCAAAAAGGG + Intergenic
1166505945 19:43371723-43371745 TTACCACCATAGCCCAAAAAGGG - Intergenic
1167880841 19:52456101-52456123 TCAGAACCCAGGCCTAGAAAAGG - Intronic
1167967747 19:53161368-53161390 TTCCAAAGCTGGTCTAAAAATGG - Intronic
928987763 2:37197449-37197471 TTTTAACCCTGGCCTACAGATGG + Intronic
934469532 2:94506180-94506202 TTTCAACCCTGGTCTATGAAAGG + Intergenic
934871620 2:97871914-97871936 TAACAGCACTGGCATAAAAATGG + Intronic
938823940 2:134985898-134985920 TAACAACTCTTGCCAAAAAATGG - Exonic
938940213 2:136163189-136163211 TTGCAAGCCTGTCCTAAAAATGG - Intergenic
939388575 2:141535000-141535022 AAACAACCCAGGCCTTAAAAAGG - Intronic
942521110 2:176805167-176805189 TTACAGCACTGGCCAGAAAATGG - Intergenic
945235733 2:207629686-207629708 TATCCACCCTGGCCTAAAAAGGG - Intergenic
948227643 2:236323944-236323966 TGAAAACCATGGCATAAAAATGG - Intergenic
1169237785 20:3945933-3945955 TTACATTCCTGAACTAAAAATGG + Intronic
1173792371 20:45835957-45835979 TTTCAGGCCTGGCCTGAAAAGGG - Intronic
1174101847 20:48132802-48132824 TTACAAACATCACCTAAAAATGG - Intergenic
1175467339 20:59198244-59198266 TTAGAGCACTGGCCTAATAAGGG - Intronic
949294258 3:2502323-2502345 TTAAAACCCTGGTTTAAAACTGG - Intronic
949549314 3:5099128-5099150 TTACAACGCAGCCATAAAAAAGG - Intergenic
952577329 3:34790954-34790976 TCTCAACCCTGGCATCAAAAGGG - Intergenic
957191193 3:77011669-77011691 TTACCACTCAGGCCTGAAAAAGG - Intronic
959371438 3:105532090-105532112 TTACAACACTGGCTAAATAAAGG - Intronic
964615040 3:158654602-158654624 TTAAAAGCCAGGCCTACAAATGG - Exonic
967681082 3:192364580-192364602 TAAAAACCTTGGCCTGAAAATGG - Intronic
969364617 4:6686928-6686950 ATGGAACCCTGGCCCAAAAAAGG + Intergenic
970852748 4:20620898-20620920 TACCAACCCTGGCCTAAGAGTGG - Intergenic
972559386 4:40213400-40213422 TTACAAACCTGGCCCAAGATGGG - Intronic
972814609 4:42630221-42630243 TTACCACCCTGCCCCAAAGAGGG + Intronic
973525134 4:51702670-51702692 TTACAAACCTGCTCTATAAAAGG - Intergenic
974155095 4:58061291-58061313 TTTCAGCCCTGTCCAAAAAATGG - Intergenic
975161848 4:71133608-71133630 TTCCAAGACTAGCCTAAAAAAGG - Intergenic
975439213 4:74391552-74391574 GTACACCCCTGGCCAAAGAAGGG + Intergenic
976901183 4:90178399-90178421 TTAAAATACTGCCCTAAAAATGG - Intronic
979366676 4:119833303-119833325 TTAGAACCATGGCCTTGAAAAGG - Intergenic
979720059 4:123888850-123888872 TTACATCCCTGGGCTTAACATGG - Intergenic
979982899 4:127278002-127278024 TTACAAACCTGGGCTTCAAAAGG - Intergenic
980030550 4:127824759-127824781 TAACACCACTGACCTAAAAAAGG - Intronic
984290425 4:177787422-177787444 TTTCAAGCCTGGCCAAAAACTGG - Intronic
984398045 4:179225880-179225902 GTACTGCCCAGGCCTAAAAAGGG + Intergenic
986236443 5:5914879-5914901 TTTCAAAGCTGGCCTACAAAAGG + Intergenic
995127730 5:108595655-108595677 TTACATCCTGGGCCTAAAAATGG - Intergenic
995259833 5:110090636-110090658 TGACTACCCTGGGCAAAAAAAGG + Intergenic
996195204 5:120597338-120597360 TTATAACCCTGGAATACAAATGG - Intronic
997143376 5:131406608-131406630 TTACAGCCCCAGCCTAACAAGGG - Intergenic
1000145419 5:158448929-158448951 TTACATCCCTGGCCTAAATCAGG - Intergenic
1003820445 6:9890419-9890441 ATAGAACCCTGGCTTATAAATGG + Intronic
1009611936 6:65956079-65956101 TTACTATCCTGGCTTAAAATAGG + Intergenic
1011486035 6:87842469-87842491 TTAAAACCTTGGCCAAATAATGG - Intergenic
1011748595 6:90433120-90433142 GTACAACCCTGGTCCCAAAAAGG + Intergenic
1011752418 6:90466371-90466393 TTATCACCCTTGTCTAAAAATGG + Intergenic
1014204454 6:118642266-118642288 TTACAAACCTTTCATAAAAAGGG - Intronic
1017490661 6:154941874-154941896 TTTCCACCATGGCCTACAAAAGG + Intronic
1018037231 6:159892067-159892089 TTAGAGCCCTGGTCTAAAAGGGG - Intergenic
1019193888 6:170269895-170269917 TTACAAACCTAGGCTAAAACAGG - Intergenic
1022179990 7:27909804-27909826 TATCAATCATGGCCTAAAAAGGG - Intronic
1024045858 7:45585157-45585179 AAACAACCGTGGCCTCAAAAAGG + Intronic
1025273942 7:57556918-57556940 CTACAAGCCTAGCCAAAAAAAGG + Intergenic
1025634500 7:63309718-63309740 TTACCACCCTGGCTTTAAGATGG - Intergenic
1025648197 7:63438456-63438478 TTACCACCCTGGCTTTAAGATGG + Intergenic
1031646628 7:124234191-124234213 TTAAAATTCTGGCCTAAATAAGG + Intergenic
1033106079 7:138525656-138525678 TTACAATACTGGCAAAAAAATGG - Intronic
1034902392 7:154915567-154915589 TCACCACCCTGGTCTAGAAATGG - Intergenic
1041758239 8:61337161-61337183 TTACTACTTTGGTCTAAAAAAGG - Intronic
1041834374 8:62195433-62195455 TAGCAACCATGGCTTAAAAATGG - Intergenic
1044244205 8:89922174-89922196 TTACATCCCTGTTCTAACAAAGG - Intronic
1052151219 9:25118215-25118237 ATACAACACTGAACTAAAAATGG + Intergenic
1052475510 9:28954807-28954829 TCTCCACCCTGGCCTAAAAGAGG - Intergenic
1052752626 9:32508144-32508166 TTAAATCCCTTGCCTCAAAAGGG - Intronic
1053377397 9:37619278-37619300 TCACAACCCGGGCCTATAACTGG + Intronic
1053975747 9:43813770-43813792 TTTCAAACCTGCCCTATAAAAGG - Intergenic
1054017575 9:44540053-44540075 TTTCAACCCTGCTCTATAAAAGG - Intergenic
1054425111 9:65057767-65057789 TTTCAAACCTGGCCTATGAAAGG - Intergenic
1061516592 9:131093651-131093673 TTGGAACCCTGGAGTAAAAACGG + Intronic
1203340578 Un_KI270311v1:11044-11066 TTACAACGAAGGCCTCAAAAAGG - Intergenic
1186729690 X:12396015-12396037 CTACCAAGCTGGCCTAAAAAAGG - Intronic
1191574637 X:62685574-62685596 TTTCAACACAGGCCTAAAAAGGG - Intergenic
1193205526 X:78742983-78743005 TTAAAACAATGGCCAAAAAAAGG - Intergenic
1197151178 X:123221618-123221640 TTACAACCTTGGCCAAAGGAGGG + Intronic
1201781078 Y:17723540-17723562 TTACAGACCTGGCTTAGAAAAGG + Intergenic
1201820475 Y:18182450-18182472 TTACAGACCTGGCTTAGAAAAGG - Intergenic