ID: 1117590761

View in Genome Browser
Species Human (GRCh38)
Location 14:57265804-57265826
Sequence CAGGATAGACATTCTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117590761_1117590764 3 Left 1117590761 14:57265804-57265826 CCTTACTCAGAATGTCTATCCTG 0: 1
1: 0
2: 0
3: 6
4: 153
Right 1117590764 14:57265830-57265852 AGATTTTAAAACACTGTACATGG 0: 1
1: 1
2: 2
3: 26
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117590761 Original CRISPR CAGGATAGACATTCTGAGTA AGG (reversed) Intronic
902005383 1:13227807-13227829 AAGGCTAGAACTTCTGAGTAGGG + Intergenic
902024724 1:13374197-13374219 AAGGCTAGAACTTCTGAGTAGGG + Intergenic
902132071 1:14270590-14270612 TAGGATAGACCTCCTCAGTAAGG - Intergenic
905511211 1:38521932-38521954 CAGAATAGAAATTCAGAGTTGGG + Intergenic
908550690 1:65206041-65206063 CAAGACAGACCTTCTGAGGAAGG - Intronic
910291995 1:85608248-85608270 CAGGAGAGATATTTGGAGTACGG + Intergenic
910729905 1:90383870-90383892 CAGGATAGAAATACTAACTATGG - Intergenic
911761291 1:101620230-101620252 TTGGATATAGATTCTGAGTATGG + Intergenic
913647941 1:120879013-120879035 CAAGATAGACATTCATAGTTAGG + Intergenic
922145093 1:222935473-222935495 CAACATAGAGATTCTAAGTAAGG - Intronic
922789217 1:228301193-228301215 TAGGATGGACATTCTGAATCAGG + Intronic
1064655441 10:17551372-17551394 CAGGAGAGAGATTCTGTGTCTGG - Intergenic
1066043606 10:31577876-31577898 CAGGAAAGACATTGAGACTAAGG - Intergenic
1066300508 10:34091675-34091697 CAGAATCTACATTCTGAGGATGG + Intergenic
1066460631 10:35609109-35609131 CAGGAGATATATTCTCAGTACGG + Intergenic
1068172450 10:53412944-53412966 GAGCTTAGAGATTCTGAGTATGG - Intergenic
1068261245 10:54585229-54585251 CAGGATAGATATTCCAATTAAGG - Intronic
1071149579 10:82618481-82618503 CAGGATAGACAGTGTGAGACAGG - Intronic
1074025445 10:109628899-109628921 GAGAATAGACATTCTGAATATGG - Intergenic
1074331280 10:112512231-112512253 CATAATAGCCATTCTGACTAGGG + Intronic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1077754503 11:5011794-5011816 AAGCATAGATGTTCTGAGTAAGG - Intergenic
1079329001 11:19518792-19518814 CAGCATAGGAATTTTGAGTAGGG - Intronic
1079489388 11:20970633-20970655 CAGGAAGGCCATTCTCAGTAGGG + Intronic
1081365236 11:42226909-42226931 CAGGAAAGATACTTTGAGTAAGG - Intergenic
1084033020 11:66492214-66492236 CAGGATGGACATTGTGACTGTGG + Intronic
1084778926 11:71396279-71396301 CAGGACAGACATCATGAGGAAGG - Intergenic
1085256042 11:75173685-75173707 CAGGATAGCCATTCTGGGCCAGG + Intronic
1087920577 11:103862270-103862292 CAGGACAGTCATTCTGAATGTGG + Intergenic
1089363419 11:117906057-117906079 CAGGAGAGACCCTCTCAGTAGGG - Intronic
1091472085 12:737770-737792 CAGGATAGACATCCTGAGGGAGG - Intergenic
1092530106 12:9336836-9336858 TAGGACAGACATTCTCAGAACGG + Intergenic
1092756708 12:11770324-11770346 CAGGATGGGCATTCAGAGGAAGG + Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1093493321 12:19728168-19728190 CAGAACAGACATTCTTATTATGG - Intergenic
1094117662 12:26935048-26935070 AGGGATAGACAATCTGGGTACGG + Intronic
1096918521 12:55059161-55059183 CAGGATAGAGACTGGGAGTAGGG + Intergenic
1097706167 12:62870571-62870593 CAGATTAGACATGCTGAATAGGG + Intronic
1098749996 12:74280771-74280793 CAGCATAGAAATTCTGACCAAGG + Intergenic
1099666544 12:85637526-85637548 CAGGATAGTTATTTTGAGGATGG + Intergenic
1102052789 12:109875242-109875264 TAGGAGAGACATTCTGGATAAGG + Intronic
1103729804 12:123019932-123019954 CAGGACAGATATGCTGGGTAGGG + Intronic
1104577296 12:129979641-129979663 TAGGGTAGATTTTCTGAGTAAGG - Intergenic
1106529890 13:30580796-30580818 CATGATAGAAATTCTCAGAAAGG - Intronic
1107060446 13:36154583-36154605 CTGGAGAGACATTCTCACTAGGG - Intergenic
1109427543 13:62185768-62185790 CAGAATAGACATTCTGTAAAAGG - Intergenic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1110740441 13:78989932-78989954 CAGCAAAGACATTCTAAGCAGGG + Intergenic
1117590761 14:57265804-57265826 CAGGATAGACATTCTGAGTAAGG - Intronic
1118488713 14:66238257-66238279 CAGGAAAGGAATGCTGAGTAGGG - Intergenic
1121868587 14:97386013-97386035 AAGGCAAGAGATTCTGAGTAGGG + Intergenic
1122224881 14:100269405-100269427 CAGCATAGACATTATGAATGAGG - Intronic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1127842898 15:62845968-62845990 CAGGAGAGAGATTCTGTGCAGGG + Intergenic
1130095547 15:80853073-80853095 CAGGAGAGACATTGAGAATAGGG + Intronic
1131101788 15:89696866-89696888 CAGGACAGCCACTCTGAGAAAGG - Intronic
1131580505 15:93638318-93638340 AAGGTGACACATTCTGAGTATGG - Intergenic
1138190819 16:55012573-55012595 CAGGTTAGTCTTTCTGAGTCTGG + Intergenic
1144359122 17:14475006-14475028 CAAGTTAGACCTTCTGAATAAGG - Intergenic
1146551446 17:33783622-33783644 CAGGAGAGCCAGTCTGATTAAGG - Intronic
1152237133 17:79144449-79144471 CAGGAAAGAGCTTCTGAGTGAGG - Intronic
1152237971 17:79148308-79148330 CAGGAAAGAGTTTCTGAGTGAGG - Intronic
1155366692 18:25056207-25056229 CAGGATAGAAAATCAGAGGATGG - Intergenic
1158485711 18:57864151-57864173 GAGGAAAGCCAGTCTGAGTAAGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
927073864 2:19557003-19557025 CTGGATGGAAATTCTGAGTCTGG + Intergenic
931644268 2:64407336-64407358 AATGATAGCCATTCTGACTATGG - Intergenic
932544791 2:72697030-72697052 CAGGATAGACATTTAGAGAGAGG - Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
936815678 2:116457232-116457254 CAGGATACACATTCTCACCAGGG - Intergenic
938178049 2:129154259-129154281 CAGGATGGACATTCTCACCAAGG - Intergenic
939358269 2:141133099-141133121 CTGGCTAGACATTCTCAGTCGGG - Intronic
939462026 2:142509339-142509361 GAGGACATACCTTCTGAGTAAGG + Intergenic
940398484 2:153221153-153221175 CAGAAAAGACATTGTCAGTATGG + Intergenic
944316760 2:198292729-198292751 CAGGCAAGACCCTCTGAGTAGGG - Intronic
946202658 2:218079956-218079978 CAGGATAGTCATTCAGACTGGGG + Intronic
1172848771 20:37945438-37945460 CAGGAGAGAGATGCTGAGTGAGG - Intergenic
1173032589 20:39376092-39376114 AAGGATAGAAATTCAAAGTAGGG - Intergenic
1174373631 20:50111488-50111510 CAGAAGAGAGATTCTGAGTCAGG - Intronic
1180678257 22:17603901-17603923 AGGGATAGACAGCCTGAGTATGG + Intronic
1184509010 22:44921199-44921221 CAGGGTGGACATTCAGGGTAAGG + Intronic
1184882896 22:47322703-47322725 CAGGATATAGCTTCTGAGTCTGG - Intergenic
952608358 3:35177563-35177585 AAAGATAGATTTTCTGAGTATGG + Intergenic
952880292 3:37981233-37981255 TAGGAAAGAGATTCTGAGTTGGG - Exonic
960613202 3:119573500-119573522 CAGGATGGCCATTCTCAGTCTGG + Intergenic
961931507 3:130538824-130538846 TAGGAGAGAAATTCTGAGCAGGG - Intergenic
961937052 3:130595853-130595875 CTGTAAAGACAATCTGAGTATGG - Intronic
965953181 3:174335469-174335491 CAAGAAAGACATTCTGTGTTGGG - Intergenic
966982447 3:185150948-185150970 CAGGAAAGACATTGTGAGAATGG + Intronic
970112358 4:12652456-12652478 CTGGGCAGACATTCTGAGTGGGG + Intergenic
971045810 4:22803853-22803875 CAGGATGGACAGTCTGGGTGAGG + Intergenic
971225674 4:24749353-24749375 GAGAATAGAGCTTCTGAGTAAGG + Intergenic
972294660 4:37725321-37725343 CAGGGTAGGTATGCTGAGTATGG + Intergenic
973731080 4:53822829-53822851 AAGGGCAGACATTCTGAGCATGG + Intronic
974918736 4:68210050-68210072 CAGCATAGATATTTTGAGTGTGG - Intergenic
975460072 4:74641441-74641463 TAGCATATACATTCTGAGTCAGG + Intergenic
976266797 4:83192716-83192738 CAGGGTGGCCATTCTGAGTCTGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
979810694 4:125032147-125032169 CAGGACAGAAATTCTGAGCTGGG - Intergenic
983702571 4:170615656-170615678 CAGGGTAGAGATATTGAGTAAGG - Intergenic
985797986 5:1978466-1978488 CAAGATAGACATACAGAGCAAGG + Intergenic
987362787 5:17122010-17122032 CAGCAAAGACAGTCTGGGTAAGG - Intronic
988130074 5:27092682-27092704 TAGGTTAAACATTCTGAGTTAGG + Intronic
988534972 5:32059096-32059118 CTGGATTTACATTCTGAGTCTGG + Intronic
989737045 5:44720233-44720255 AAGGCTAGACACTTTGAGTAAGG - Intergenic
994728057 5:103459716-103459738 CAGGACAGATATACTGAGGATGG + Intergenic
996976625 5:129441676-129441698 AAGAATAGACATTCAGAGTTTGG + Intergenic
997475698 5:134141181-134141203 CAGGAGAGTCCTTCTAAGTAGGG - Intronic
997805200 5:136910647-136910669 CAGGTTAGGAATTATGAGTAAGG + Intergenic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998660967 5:144237126-144237148 TAGGAGAAACATTCTGGGTAGGG - Intronic
1003664549 6:8098521-8098543 CAGGATACAGATTCAAAGTAAGG + Intronic
1004391061 6:15210207-15210229 CAGAAGAGCCATTCTGAGGAAGG + Intergenic
1008109178 6:47474194-47474216 CAGTATAGGCATTCTGATTGAGG + Intergenic
1010967037 6:82222699-82222721 CAGGTGACACATTATGAGTATGG + Intronic
1011824092 6:91286364-91286386 CAGGAGAGAGAGGCTGAGTATGG + Intergenic
1011882331 6:92045226-92045248 CAGGAATGACATTCTAAGAAAGG - Intergenic
1014346202 6:120272768-120272790 TAGGATAGACATTCTGAAAAGGG + Intergenic
1014386711 6:120812355-120812377 AATGATAGCCATTCTGATTAGGG - Intergenic
1016341699 6:143068412-143068434 CAGGGTAGCCCTTCTGAGTGCGG + Intronic
1022858321 7:34339122-34339144 AAGGAAGGACCTTCTGAGTATGG + Intergenic
1023750601 7:43368591-43368613 GAGGTTAGAGATTGTGAGTAGGG - Intronic
1024618045 7:51132507-51132529 CAGGATTAAGATTGTGAGTAGGG - Intronic
1027656245 7:80934176-80934198 GAAGATAGACATACTGAATAAGG - Intergenic
1029259723 7:99293583-99293605 CAGGAGAGACTCTCTGAGAAGGG - Intergenic
1029915327 7:104203116-104203138 CAGGAAAGCCATTCCAAGTAGGG + Intronic
1030854413 7:114535213-114535235 CAGGACAAACATAGTGAGTAAGG - Intronic
1034359068 7:150478096-150478118 CAGGATAGACACTGTGATCAAGG + Exonic
1034891311 7:154841619-154841641 CATGATAGGCATTTTGAATAAGG - Intronic
1036108147 8:5864706-5864728 CTGTATAGAAATTCTGAGTTAGG - Intergenic
1040604562 8:48918846-48918868 CAGGAGAGACATTCTGGAGAAGG + Exonic
1042963801 8:74329853-74329875 AAGGATAGACGTTCTGGGTATGG + Intronic
1043200009 8:77355315-77355337 AAGGATAGACATACAGAGCAAGG - Intergenic
1043524274 8:81079598-81079620 CAGGAGAGACACTCAGAGTTGGG + Intronic
1044270445 8:90236517-90236539 CAAAATAAACATTCTGAATAAGG + Intergenic
1044957004 8:97491541-97491563 CAGGATAGCAGTTCTGAGTTAGG - Intergenic
1045252970 8:100496638-100496660 CAGGATAGAAAACCTGAGAAGGG + Intergenic
1046232998 8:111382184-111382206 AAGAATAGCCATTCTGGGTAGGG + Intergenic
1046481782 8:114829375-114829397 TAGCATAGACTTTCTGTGTATGG + Intergenic
1051145932 9:14027271-14027293 GAGGATGGACACTCTGAGCACGG - Intergenic
1051247364 9:15125558-15125580 AAGAATAGACATGCTGAGTGAGG + Intergenic
1052240432 9:26265762-26265784 TAGGTTAGACATTCTGAGGTAGG - Intergenic
1056957684 9:91095721-91095743 CAGAATTGCCATTCTGAGTCGGG - Intergenic
1057962866 9:99473699-99473721 CAGGACAGACATTCTGAAGATGG - Intergenic
1058590923 9:106564986-106565008 CAGGATTCACATGCTGATTACGG - Intergenic
1060765525 9:126293005-126293027 CAGGATAGGCGATCTGAGAAGGG + Intergenic
1186716863 X:12261165-12261187 CTGGATAGAGATTTTGAGTCTGG + Intronic
1187227445 X:17387193-17387215 GATGATAGATATTGTGAGTAAGG - Intronic
1187614206 X:20975512-20975534 CAGGATTGACTTTCAAAGTAGGG + Intergenic
1188571737 X:31594626-31594648 CAGGATGAAAATTCTGAGTTTGG - Intronic
1189356917 X:40316892-40316914 CAGGAGAAAAAATCTGAGTAAGG + Intergenic
1191607150 X:63074920-63074942 CAGGAAAGACATACTGGGTTTGG + Intergenic
1193126421 X:77875297-77875319 TACCATAGACATCCTGAGTAAGG + Intronic
1194546256 X:95238670-95238692 CAGCATATACATTCAGAGTCAGG + Intergenic
1197292374 X:124674633-124674655 AAGGATAGTGGTTCTGAGTAAGG + Intronic
1197882097 X:131177754-131177776 GAGGAGAGACATACTTAGTAAGG + Intergenic
1198523213 X:137473675-137473697 GAGGAAAGACTTTCTGAGAAGGG + Intergenic
1199217247 X:145274260-145274282 CAGCATAGAAATTCTAAATATGG - Intergenic