ID: 1117595325

View in Genome Browser
Species Human (GRCh38)
Location 14:57321221-57321243
Sequence CCACCAAGTATGTTTTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117595317_1117595325 21 Left 1117595317 14:57321177-57321199 CCTGCCTTGGCCTCTCAAAGTGC 0: 2374
1: 63941
2: 180472
3: 230185
4: 181486
Right 1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG No data
1117595319_1117595325 17 Left 1117595319 14:57321181-57321203 CCTTGGCCTCTCAAAGTGCTGGG 0: 3426
1: 88409
2: 209951
3: 234159
4: 151859
Right 1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG No data
1117595316_1117595325 24 Left 1117595316 14:57321174-57321196 CCACCTGCCTTGGCCTCTCAAAG 0: 1185
1: 28746
2: 78716
3: 152720
4: 158266
Right 1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG No data
1117595321_1117595325 11 Left 1117595321 14:57321187-57321209 CCTCTCAAAGTGCTGGGATTACA 0: 11074
1: 304386
2: 264969
3: 149159
4: 134834
Right 1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117595325 Original CRISPR CCACCAAGTATGTTTTAAAG TGG Intergenic
No off target data available for this crispr