ID: 1117598571

View in Genome Browser
Species Human (GRCh38)
Location 14:57349481-57349503
Sequence TGTGACTCATTGGGAATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117598566_1117598571 11 Left 1117598566 14:57349447-57349469 CCACTTCTGCACACAAGAGAAGA No data
Right 1117598571 14:57349481-57349503 TGTGACTCATTGGGAATCACTGG No data
1117598565_1117598571 12 Left 1117598565 14:57349446-57349468 CCCACTTCTGCACACAAGAGAAG No data
Right 1117598571 14:57349481-57349503 TGTGACTCATTGGGAATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117598571 Original CRISPR TGTGACTCATTGGGAATCAC TGG Intergenic
No off target data available for this crispr