ID: 1117599616

View in Genome Browser
Species Human (GRCh38)
Location 14:57361963-57361985
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117599616_1117599619 2 Left 1117599616 14:57361963-57361985 CCGGAAGCTAGAGAGTGGCAAGG No data
Right 1117599619 14:57361988-57362010 GGATTCTGCCTCAGAAAGTATGG No data
1117599616_1117599622 25 Left 1117599616 14:57361963-57361985 CCGGAAGCTAGAGAGTGGCAAGG No data
Right 1117599622 14:57362011-57362033 CCTTGCCAACACTTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117599616 Original CRISPR CCTTGCCACTCTCTAGCTTC CGG (reversed) Intergenic
No off target data available for this crispr