ID: 1117602010

View in Genome Browser
Species Human (GRCh38)
Location 14:57385837-57385859
Sequence GATTTACTCTTATGTCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117602010_1117602011 -2 Left 1117602010 14:57385837-57385859 CCTGATTGACATAAGAGTAAATC No data
Right 1117602011 14:57385858-57385880 TCCAGCCCCTTTCCAGTGTCTGG No data
1117602010_1117602015 4 Left 1117602010 14:57385837-57385859 CCTGATTGACATAAGAGTAAATC No data
Right 1117602015 14:57385864-57385886 CCCTTTCCAGTGTCTGGCTCAGG No data
1117602010_1117602018 10 Left 1117602010 14:57385837-57385859 CCTGATTGACATAAGAGTAAATC No data
Right 1117602018 14:57385870-57385892 CCAGTGTCTGGCTCAGGAATAGG No data
1117602010_1117602019 28 Left 1117602010 14:57385837-57385859 CCTGATTGACATAAGAGTAAATC No data
Right 1117602019 14:57385888-57385910 ATAGGCCAGTGATCCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117602010 Original CRISPR GATTTACTCTTATGTCAATC AGG (reversed) Intergenic