ID: 1117605851

View in Genome Browser
Species Human (GRCh38)
Location 14:57428342-57428364
Sequence CAGGTAATACACATTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117605851_1117605853 11 Left 1117605851 14:57428342-57428364 CCTTGTTCAATGTGTATTACCTG No data
Right 1117605853 14:57428376-57428398 ATTTATTAGCCTCTTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117605851 Original CRISPR CAGGTAATACACATTGAACA AGG (reversed) Intergenic
No off target data available for this crispr