ID: 1117607104 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:57440947-57440969 |
Sequence | GTGATTGTGGGGCTTTTCAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1117607104_1117607113 | 22 | Left | 1117607104 | 14:57440947-57440969 | CCCCTGAAAAGCCCCACAATCAC | No data | ||
Right | 1117607113 | 14:57440992-57441014 | CACAGATTCTCTATGCCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1117607104 | Original CRISPR | GTGATTGTGGGGCTTTTCAG GGG (reversed) | Intergenic | ||