ID: 1117607106 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:57440949-57440971 |
Sequence | CAGTGATTGTGGGGCTTTTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1117607106_1117607113 | 20 | Left | 1117607106 | 14:57440949-57440971 | CCTGAAAAGCCCCACAATCACTG | No data | ||
Right | 1117607113 | 14:57440992-57441014 | CACAGATTCTCTATGCCATGTGG | No data | ||||
1117607106_1117607114 | 30 | Left | 1117607106 | 14:57440949-57440971 | CCTGAAAAGCCCCACAATCACTG | No data | ||
Right | 1117607114 | 14:57441002-57441024 | CTATGCCATGTGGCTACTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1117607106 | Original CRISPR | CAGTGATTGTGGGGCTTTTC AGG (reversed) | Intergenic | ||