ID: 1117607106 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:57440949-57440971 |
| Sequence | CAGTGATTGTGGGGCTTTTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1117607106_1117607113 | 20 | Left | 1117607106 | 14:57440949-57440971 | CCTGAAAAGCCCCACAATCACTG | No data | ||
| Right | 1117607113 | 14:57440992-57441014 | CACAGATTCTCTATGCCATGTGG | No data | ||||
| 1117607106_1117607114 | 30 | Left | 1117607106 | 14:57440949-57440971 | CCTGAAAAGCCCCACAATCACTG | No data | ||
| Right | 1117607114 | 14:57441002-57441024 | CTATGCCATGTGGCTACTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1117607106 | Original CRISPR | CAGTGATTGTGGGGCTTTTC AGG (reversed) | Intergenic | ||