ID: 1117607106

View in Genome Browser
Species Human (GRCh38)
Location 14:57440949-57440971
Sequence CAGTGATTGTGGGGCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607106_1117607113 20 Left 1117607106 14:57440949-57440971 CCTGAAAAGCCCCACAATCACTG No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607106_1117607114 30 Left 1117607106 14:57440949-57440971 CCTGAAAAGCCCCACAATCACTG No data
Right 1117607114 14:57441002-57441024 CTATGCCATGTGGCTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607106 Original CRISPR CAGTGATTGTGGGGCTTTTC AGG (reversed) Intergenic