ID: 1117607108

View in Genome Browser
Species Human (GRCh38)
Location 14:57440959-57440981
Sequence AGAGAAAGAACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607108_1117607114 20 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607114 14:57441002-57441024 CTATGCCATGTGGCTACTGCTGG No data
1117607108_1117607116 22 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607116 14:57441004-57441026 ATGCCATGTGGCTACTGCTGGGG No data
1117607108_1117607117 23 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607117 14:57441005-57441027 TGCCATGTGGCTACTGCTGGGGG No data
1117607108_1117607115 21 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607115 14:57441003-57441025 TATGCCATGTGGCTACTGCTGGG No data
1117607108_1117607113 10 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607108_1117607119 29 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607108 Original CRISPR AGAGAAAGAACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr