ID: 1117607109

View in Genome Browser
Species Human (GRCh38)
Location 14:57440960-57440982
Sequence GAGAGAAAGAACAGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607109_1117607119 28 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607109_1117607114 19 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607114 14:57441002-57441024 CTATGCCATGTGGCTACTGCTGG No data
1117607109_1117607115 20 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607115 14:57441003-57441025 TATGCCATGTGGCTACTGCTGGG No data
1117607109_1117607117 22 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607117 14:57441005-57441027 TGCCATGTGGCTACTGCTGGGGG No data
1117607109_1117607116 21 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607116 14:57441004-57441026 ATGCCATGTGGCTACTGCTGGGG No data
1117607109_1117607113 9 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607109 Original CRISPR GAGAGAAAGAACAGTGATTG TGG (reversed) Intergenic