ID: 1117607112

View in Genome Browser
Species Human (GRCh38)
Location 14:57440984-57441006
Sequence CATAGAGAATCTGTGCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607112_1117607121 9 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607121 14:57441016-57441038 TACTGCTGGGGGATGTGGAAGGG No data
1117607112_1117607114 -5 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607114 14:57441002-57441024 CTATGCCATGTGGCTACTGCTGG No data
1117607112_1117607120 8 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607120 14:57441015-57441037 CTACTGCTGGGGGATGTGGAAGG No data
1117607112_1117607123 13 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607123 14:57441020-57441042 GCTGGGGGATGTGGAAGGGGTGG No data
1117607112_1117607116 -3 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607116 14:57441004-57441026 ATGCCATGTGGCTACTGCTGGGG No data
1117607112_1117607117 -2 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607117 14:57441005-57441027 TGCCATGTGGCTACTGCTGGGGG No data
1117607112_1117607119 4 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607112_1117607115 -4 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607115 14:57441003-57441025 TATGCCATGTGGCTACTGCTGGG No data
1117607112_1117607122 10 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607122 14:57441017-57441039 ACTGCTGGGGGATGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607112 Original CRISPR CATAGAGAATCTGTGCACTT AGG (reversed) Intergenic
No off target data available for this crispr