ID: 1117607113

View in Genome Browser
Species Human (GRCh38)
Location 14:57440992-57441014
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607106_1117607113 20 Left 1117607106 14:57440949-57440971 CCTGAAAAGCCCCACAATCACTG No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607107_1117607113 11 Left 1117607107 14:57440958-57440980 CCCCACAATCACTGTTCTTTCTC No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607104_1117607113 22 Left 1117607104 14:57440947-57440969 CCCCTGAAAAGCCCCACAATCAC No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607105_1117607113 21 Left 1117607105 14:57440948-57440970 CCCTGAAAAGCCCCACAATCACT No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607109_1117607113 9 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data
1117607108_1117607113 10 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607113 14:57440992-57441014 CACAGATTCTCTATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607113 Original CRISPR CACAGATTCTCTATGCCATG TGG Intergenic