ID: 1117607119

View in Genome Browser
Species Human (GRCh38)
Location 14:57441011-57441033
Sequence GTGGCTACTGCTGGGGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607110_1117607119 6 Left 1117607110 14:57440982-57441004 CCCCTAAGTGCACAGATTCTCTA No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607111_1117607119 5 Left 1117607111 14:57440983-57441005 CCCTAAGTGCACAGATTCTCTAT No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607109_1117607119 28 Left 1117607109 14:57440960-57440982 CCACAATCACTGTTCTTTCTCTC No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607108_1117607119 29 Left 1117607108 14:57440959-57440981 CCCACAATCACTGTTCTTTCTCT No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607107_1117607119 30 Left 1117607107 14:57440958-57440980 CCCCACAATCACTGTTCTTTCTC No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data
1117607112_1117607119 4 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607119 14:57441011-57441033 GTGGCTACTGCTGGGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607119 Original CRISPR GTGGCTACTGCTGGGGGATG TGG Intergenic
No off target data available for this crispr