ID: 1117607123

View in Genome Browser
Species Human (GRCh38)
Location 14:57441020-57441042
Sequence GCTGGGGGATGTGGAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117607111_1117607123 14 Left 1117607111 14:57440983-57441005 CCCTAAGTGCACAGATTCTCTAT No data
Right 1117607123 14:57441020-57441042 GCTGGGGGATGTGGAAGGGGTGG No data
1117607110_1117607123 15 Left 1117607110 14:57440982-57441004 CCCCTAAGTGCACAGATTCTCTA No data
Right 1117607123 14:57441020-57441042 GCTGGGGGATGTGGAAGGGGTGG No data
1117607118_1117607123 -10 Left 1117607118 14:57441007-57441029 CCATGTGGCTACTGCTGGGGGAT No data
Right 1117607123 14:57441020-57441042 GCTGGGGGATGTGGAAGGGGTGG No data
1117607112_1117607123 13 Left 1117607112 14:57440984-57441006 CCTAAGTGCACAGATTCTCTATG No data
Right 1117607123 14:57441020-57441042 GCTGGGGGATGTGGAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117607123 Original CRISPR GCTGGGGGATGTGGAAGGGG TGG Intergenic