ID: 1117610073

View in Genome Browser
Species Human (GRCh38)
Location 14:57473997-57474019
Sequence AAGAAGTAGCTGGATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117610073_1117610076 6 Left 1117610073 14:57473997-57474019 CCCACTTCATCCAGCTACTTCTT 0: 1
1: 0
2: 3
3: 33
4: 392
Right 1117610076 14:57474026-57474048 GTTTAAATGTCCCTTCCTCATGG 0: 1
1: 6
2: 24
3: 125
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117610073 Original CRISPR AAGAAGTAGCTGGATGAAGT GGG (reversed) Intronic
900426842 1:2584711-2584733 AGGAAGCAGCTAGATGATGTGGG - Intergenic
901235789 1:7667038-7667060 AAAAATTAGCTGGATGCAGCAGG - Intronic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901467755 1:9433608-9433630 AAGAAGTAGCTGGAGCAGGGAGG + Intergenic
902193108 1:14777538-14777560 AAGCAGATGCTGGGTGAAGTTGG - Intronic
902911628 1:19602509-19602531 AACAAGTAGAGGGATGATGTTGG + Intronic
903331446 1:22599125-22599147 TGCAAGTAGCTGAATGAAGTTGG + Intronic
903386112 1:22927983-22928005 AAAAATTAGCTGGATGTGGTAGG + Intergenic
903494240 1:23754121-23754143 AAGAAGAAGCTGGATTTACTGGG + Exonic
904232696 1:29089719-29089741 GAGTTGTAGCTGGATGAAGCTGG + Intronic
904749585 1:32733208-32733230 AAAAATTAGCTGGATGTGGTGGG - Intergenic
905420954 1:37843757-37843779 AACAAGTAACTGGATGGATTTGG + Intronic
905766703 1:40607524-40607546 AAGAAGTAGGGTGAGGAAGTGGG - Intergenic
907286177 1:53381328-53381350 AAAAAGTAGCTGGATGTGGTGGG - Intergenic
907909444 1:58814094-58814116 AAAAATGAGCTGGATGAAGCCGG - Intergenic
907955260 1:59222235-59222257 AAGAAGTAGAGGTAAGAAGTGGG + Intergenic
908123277 1:61005907-61005929 AAGAAGCAGCTGGAGCTAGTGGG - Intronic
908689794 1:66765909-66765931 CAGAAGTAGCTGCATGAAATTGG - Intronic
909598130 1:77429863-77429885 AGGAAATAGCAGGATGAAGCAGG + Intronic
909925988 1:81438727-81438749 AATTAGTAGCTGTATGAACTTGG + Intronic
910166170 1:84329576-84329598 GAGAAGCAGCTGGATTAAGGTGG + Intronic
910173134 1:84399583-84399605 AAGAAGTAGCTGGAAAAAGAAGG + Intronic
911197224 1:95006857-95006879 AAGAAACAGTTGGAGGAAGTGGG - Intronic
911582796 1:99653684-99653706 AAGGAGAAGCTGGGTGAACTTGG - Intronic
912159306 1:106961778-106961800 AAGCAGTTGATGGATTAAGTTGG - Intergenic
912169984 1:107087695-107087717 AAGAACTATCTGGTAGAAGTGGG - Intergenic
914806445 1:150995512-150995534 AAGAAGGAGCTGGATGACCCAGG - Exonic
917369583 1:174276827-174276849 AACAGCTATCTGGATGAAGTAGG - Intronic
917381651 1:174417038-174417060 AGCAAGTAGTTGGATGAATTAGG + Intronic
918800334 1:188962191-188962213 AAGAAGAAGCTGAATGGATTTGG - Intergenic
919049093 1:192490624-192490646 AAGAATTAGCTGTGTGAACTTGG + Intergenic
920238422 1:204525787-204525809 AAAAATTAGCTAGATGCAGTGGG + Intronic
921748738 1:218768029-218768051 AAAAATTAGCTGGATGTGGTGGG + Intergenic
921971684 1:221155827-221155849 AAGAAGTGGGTGGAAAAAGTAGG + Intergenic
922116205 1:222617494-222617516 GTGAAGTAGCGGGGTGAAGTGGG + Intergenic
922660660 1:227427691-227427713 ATGAAGTAGGTGGAAGAAGAAGG - Intergenic
923156018 1:231280075-231280097 AAAAATTAGCTGGATGTAGTGGG + Intergenic
923821797 1:237451419-237451441 AAAAATTAGCTGGATGTGGTGGG + Intronic
1063579540 10:7293248-7293270 AAAAATTAGCTGGATGTGGTAGG - Intronic
1064945386 10:20782077-20782099 CAGAAATAGATGGAAGAAGTCGG + Exonic
1065046184 10:21749220-21749242 AACAAGCAGATGGATGAATTAGG + Intergenic
1065831176 10:29615307-29615329 AAGAAACAGCTGGGAGAAGTAGG - Intronic
1066577686 10:36844298-36844320 AAAAATTAGCTGGGTGTAGTGGG + Intergenic
1069312187 10:67051904-67051926 AAAAATTAGCTGGCTGTAGTGGG - Intronic
1069949240 10:72007995-72008017 AAGAAGTGGCTGGACGACGAGGG + Exonic
1070954783 10:80456417-80456439 AGGAAGTGGCAGTATGAAGTGGG + Intronic
1070976127 10:80607305-80607327 AAGAAGAGGCTGGGTGAAGCAGG + Intronic
1071138203 10:82476951-82476973 ATGAATTAACTGGATGAACTCGG - Intronic
1071713025 10:88068227-88068249 AAGTAGTAAGTGGATGAGGTAGG + Intergenic
1071797534 10:89022447-89022469 AAGAAGTAGATAAATGAAGAGGG - Intergenic
1073114913 10:101086504-101086526 AAAAAGTAGCTGGGTGTGGTGGG - Intergenic
1073357851 10:102871090-102871112 AAAAATTAGCTGGGTGTAGTGGG + Intronic
1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG + Intronic
1073615725 10:104992731-104992753 CAGAACTAGCTAGATGAAGTGGG - Intronic
1073974027 10:109079257-109079279 AAAAAGAAGCTGGATATAGTGGG - Intergenic
1075666269 10:124233238-124233260 AGGAAGGACCTGGAGGAAGTCGG - Intergenic
1075943308 10:126409827-126409849 CAGAAGGAGATGGATGAAGAGGG - Intergenic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1078731903 11:13982665-13982687 AAGAGGGAGCTGGGTGAAGAGGG + Intronic
1080401019 11:31935520-31935542 AAAAATTAGCTGGGCGAAGTGGG - Intronic
1081573944 11:44308041-44308063 AAGAGGAAGGTGGAGGAAGTGGG + Intronic
1083104466 11:60344781-60344803 ATGAAGTAGCTGAAGGAAATAGG - Intronic
1083586554 11:63863921-63863943 AAAAATTAGCTGGGTGTAGTGGG - Intronic
1083957928 11:65996684-65996706 AAGTGGTAGCTGGAGGACGTGGG + Exonic
1087404406 11:97712380-97712402 AATAAATAGCTGGATGACTTTGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1092574795 12:9769873-9769895 AAGAAGTAACAGGAGGAATTTGG - Intergenic
1094293723 12:28880414-28880436 AAGAAGTATCTGGATGTCCTAGG + Intergenic
1095246304 12:39926900-39926922 TAGAACTAGCTGGATGCAGGTGG - Intronic
1095652102 12:44623832-44623854 AATAAGCAACTGGATGAAGCTGG + Intronic
1096767930 12:53909508-53909530 AAAGAGTACCTGGATGTAGTAGG - Intergenic
1097719062 12:63000758-63000780 AAAAAGTAGCTGGATGTGGTGGG - Intergenic
1098009666 12:66037132-66037154 TAGGAGTAGGTGGAGGAAGTGGG + Intergenic
1098889559 12:75995375-75995397 CAGAAATAGCTGGATTAAGGAGG - Intergenic
1099068845 12:78019616-78019638 AGGAATCAACTGGATGAAGTTGG + Intronic
1099339585 12:81411248-81411270 AAAAAGTACCTGGAAAAAGTTGG + Intronic
1100199920 12:92287473-92287495 AAGAATTAGCTGGGTGTGGTGGG + Intergenic
1100829649 12:98506143-98506165 AAAAAATAGCTGGGTGTAGTGGG - Intergenic
1101004403 12:100387581-100387603 AATTAGCAGCTGGTTGAAGTGGG + Intronic
1101418076 12:104526418-104526440 AGGAAGTAGCCGGCTGAACTGGG - Intronic
1102024017 12:109703199-109703221 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1102764481 12:115420580-115420602 TAAAGGTAGCTAGATGAAGTGGG - Intergenic
1102855521 12:116289832-116289854 AAAAATAAGCTGGATGCAGTTGG + Intergenic
1103536283 12:121635757-121635779 AAAAATTAGCTGGATATAGTGGG - Intronic
1105761042 13:23514667-23514689 AAAAATTAGCTGGGTGTAGTTGG + Intergenic
1107522841 13:41200714-41200736 GAGCAGTAGCTGGGTGAGGTAGG - Intergenic
1107595997 13:41963636-41963658 CTTGAGTAGCTGGATGAAGTTGG + Intergenic
1108428880 13:50333927-50333949 AAAAATTAGCTGGGTGTAGTGGG + Intronic
1108601214 13:51996775-51996797 AAGAAGCAGCAGGATAAAGCAGG - Intronic
1108872864 13:55007965-55007987 AAGAAGTATCTTGTTGAGGTAGG + Intergenic
1109342488 13:61078781-61078803 AGGAAGATGCTGGAGGAAGTTGG - Intergenic
1109411106 13:61970651-61970673 AACAAGTAGTTGAATAAAGTTGG + Intergenic
1109601717 13:64639639-64639661 TAGAAGTGGCTGGATGAAGAAGG - Intergenic
1110134644 13:72051088-72051110 AGGAAGAAGGTGGATGAAATAGG - Intergenic
1111552122 13:89827024-89827046 AAGAAACAGCAGGAAGAAGTGGG - Intergenic
1111587182 13:90297084-90297106 AAAAAGTAGCTGGACATAGTAGG + Intergenic
1112440601 13:99422097-99422119 AAGAAGTCTCTGGATGATGTGGG - Intergenic
1112894809 13:104285959-104285981 AAGCAGGAGCTGAAAGAAGTTGG + Intergenic
1115544204 14:34450223-34450245 AATTAGTAGCAGGATGAACTTGG - Intronic
1116147056 14:41087819-41087841 AAGAAGTAGGTGGTTGGAGGTGG - Intergenic
1116658850 14:47682065-47682087 AAGAAGTACCTTGAAGAAGGGGG + Intergenic
1117396426 14:55314865-55314887 GAGAAGTGGGGGGATGAAGTGGG - Intronic
1117610073 14:57473997-57474019 AAGAAGTAGCTGGATGAAGTGGG - Intronic
1118869672 14:69730713-69730735 AAGAAAAAGCTGGGTGATGTAGG - Intronic
1118975169 14:70670504-70670526 AAGAATTAGCTGGGCGCAGTGGG + Intronic
1119178382 14:72586697-72586719 AAGATGTTTCGGGATGAAGTAGG - Intergenic
1119205530 14:72791086-72791108 CAGAGGTAGCTGTATGAAGAGGG - Intronic
1121135405 14:91493341-91493363 ATAAATTAGCTGGATGAGGTAGG + Intronic
1121973253 14:98378744-98378766 AGGAAGAAACTGGATGAATTAGG + Intergenic
1124851299 15:33341188-33341210 AAAAATTAGCTGGGTGCAGTGGG - Intronic
1125385312 15:39130686-39130708 AGGAAGCAGCTGGATGCAGATGG + Intergenic
1126324404 15:47460995-47461017 AGGAAGTGGCTGGAGGAAGCAGG - Intronic
1126391005 15:48152042-48152064 AAGAAGTAGCTGCACAAGGTAGG - Intronic
1127026015 15:54807558-54807580 AAGAGGTAACTGGATGGATTGGG + Intergenic
1127749948 15:62026798-62026820 AAGAATTCCCTTGATGAAGTAGG - Intronic
1128307955 15:66612336-66612358 AAAAATTAGCTGGATGTGGTGGG + Intronic
1128308660 15:66616822-66616844 AAGATGTTGCAGGGTGAAGTTGG + Intronic
1128358700 15:66945672-66945694 AAAAAGTACCTGGAAGAAGATGG - Intergenic
1128517458 15:68351543-68351565 AAGAAGTAGCTGGATTGAGATGG + Intronic
1128808770 15:70554964-70554986 TAGGAGTGGCTGGATGAGGTGGG + Intergenic
1129081461 15:73044846-73044868 AAAAATTAGCTGGATGTGGTGGG - Intergenic
1129392388 15:75226836-75226858 GTGAAGTGGCGGGATGAAGTGGG - Intergenic
1129472007 15:75761348-75761370 GTGAAGTGGCGGGATGAAGTGGG + Intergenic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1130226947 15:82066391-82066413 AAGATGGAGCTGGAGGGAGTGGG - Intergenic
1130676976 15:85961459-85961481 ACACAGTAGCTGGATGAACTTGG + Intergenic
1131031411 15:89189012-89189034 AAAGAGTAGATGAATGAAGTGGG - Intronic
1131091874 15:89629613-89629635 GAGGATTAGCTGGATGAAGAGGG - Intronic
1131833510 15:96368904-96368926 AAGAAGTGGCTGGATGGCGGAGG + Intergenic
1131867212 15:96723926-96723948 AACAAGAAGCTGGCTGAATTTGG - Intergenic
1132052708 15:98621304-98621326 AAAAATTAGATGGATGAATTAGG + Intergenic
1133068343 16:3227090-3227112 AAAAATTAGCTGGATGTGGTGGG - Intronic
1133206024 16:4234142-4234164 TAAAAATAGCTGGATGTAGTGGG - Intronic
1133849166 16:9485746-9485768 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1134011071 16:10853604-10853626 AAGAATTAGCTGGGTGTGGTGGG - Intergenic
1135738739 16:24955501-24955523 AAGAAGTATCTGGTTGAATTTGG + Intronic
1135963423 16:27016405-27016427 AAGAAGAAGAAGGAGGAAGTGGG - Intergenic
1136240077 16:28938151-28938173 AAGAAGAAACTGGAGGGAGTCGG - Intronic
1138892586 16:61163513-61163535 AAGAACTAGCTGGTTGATTTGGG + Intergenic
1139147634 16:64343611-64343633 GAGAAGAAACTGGCTGAAGTGGG + Intergenic
1139764486 16:69215457-69215479 AAGAAGTACCTGGAATGAGTAGG - Intronic
1140468377 16:75200275-75200297 AAAAAGTAGCTGGGTGCAGCGGG - Intergenic
1141495239 16:84405227-84405249 AAGAAATACCTGGATCAGGTAGG + Exonic
1142956724 17:3527829-3527851 GAGAAGTAGATGGATGAAGTAGG + Intronic
1143620283 17:8076522-8076544 GGGAGGGAGCTGGATGAAGTTGG - Intronic
1144394559 17:14831585-14831607 TGGAAGTAGCAGGATGATGTTGG - Intergenic
1144516368 17:15919820-15919842 AAAAAGTGGCTGGAGAAAGTGGG - Intergenic
1145908423 17:28528863-28528885 AGGAAGGAGCTGGAGGAAGAGGG + Intronic
1146352262 17:32104580-32104602 AAGAAGCAGCTAGATGAACCTGG + Intergenic
1146577129 17:34004397-34004419 AAGAAGTAGTGGTATGCAGTAGG + Intronic
1146804169 17:35851983-35852005 AAAAATTAGCTGGGTGCAGTGGG - Intronic
1146941665 17:36847691-36847713 AAGAATTGGCTGGGTGAAGTGGG - Intergenic
1147045706 17:37750518-37750540 AACAAGTAGCTGGCTGCATTTGG + Intergenic
1147862690 17:43532931-43532953 AAGACGGAGCTGGATGTGGTTGG + Exonic
1148021599 17:44557382-44557404 AAGAAGTCGCTGGGTGCAGAAGG + Intergenic
1148212303 17:45815962-45815984 AAGAATCAGCTAAATGAAGTTGG - Intronic
1148597397 17:48867564-48867586 AAAAAATAGCTGGGTGTAGTGGG + Intergenic
1149745723 17:59095867-59095889 AAAAATTAGCTGGATGTGGTGGG - Intronic
1149869767 17:60170918-60170940 AAGAAGCAGCTGGATGAACCTGG + Intergenic
1151342409 17:73480442-73480464 AAGAAGGAGCTGGATGGCTTGGG + Intronic
1152820617 17:82435938-82435960 AAGAAGGTGCTGTAGGAAGTGGG + Intronic
1152996688 18:413993-414015 AAGAAGTAGGTGGAGGAAAGGGG + Intronic
1153406103 18:4741571-4741593 AAGTAGTAGGTAGATGAATTGGG - Intergenic
1153764369 18:8361541-8361563 ATTAACTAGCTGTATGAAGTTGG - Intronic
1154070044 18:11146152-11146174 AAGAATGAGCTGGATAAAGAAGG + Intronic
1155974492 18:32113784-32113806 AAGAAGTATCAGGATGAATATGG + Exonic
1156090777 18:33466233-33466255 AACAGGGAGCTGGATGGAGTTGG + Intergenic
1156753184 18:40486205-40486227 AAAAATTAGCTGGATGTGGTGGG - Intergenic
1157793880 18:50558029-50558051 AAGAAACAGCTGGCTGAAGTCGG - Intergenic
1158322682 18:56280693-56280715 AAGAATTATCTGGATGGAATAGG + Intergenic
1161684938 19:5697989-5698011 AAGGAGCAGCTGGGTGAAGGTGG - Intronic
1162107223 19:8377343-8377365 AAAAATTAGCTGGGTGCAGTGGG - Intronic
1162316866 19:9944523-9944545 AAGAATTACCTGGGTGAGGTTGG - Intergenic
1162738550 19:12760475-12760497 AAAAATTAGCTGGGTGTAGTGGG - Intergenic
1162768592 19:12935422-12935444 AAAAATTAGCTGGGTGCAGTGGG + Intergenic
1163281971 19:16324070-16324092 AAAAATTAGCTGGGTGTAGTGGG - Intergenic
1163491172 19:17617933-17617955 AAGTAGTAGCGGGAAGAATTGGG - Intronic
1164009909 19:21192318-21192340 AAAAATTAGCTGGGTGTAGTAGG - Exonic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1165960121 19:39526938-39526960 AAAAATTAGCTGGATGTGGTGGG - Intergenic
1167485286 19:49759172-49759194 AAAAATTAGCTGGGTGAAGCCGG + Intronic
1168532350 19:57139767-57139789 TAGATGTAGCTGGAAGAATTAGG - Intronic
1168643452 19:58044977-58044999 AACAAGAAGCTGGAGGAAGGCGG + Intronic
926050001 2:9738662-9738684 AGGAAGTGTCTGGATGAATTTGG - Intergenic
926392945 2:12412739-12412761 GAAAAGTAGCTGTATGAAGATGG + Intergenic
926618123 2:15020048-15020070 AAATAGTAGCTGTATGAACTTGG - Intergenic
927028582 2:19096409-19096431 AAGAAGAAGGTGGAAGAAGGTGG + Intergenic
929359572 2:41069793-41069815 CAGTATTAGCTGGATAAAGTAGG + Intergenic
930243943 2:48964303-48964325 AAGAGATAGCTGGATCAAGATGG - Intronic
930313410 2:49770384-49770406 AAGATGGGGCTGGATGAAATCGG - Intergenic
930646204 2:53911062-53911084 AAAAAGTAGCTGAATTAAATGGG + Intronic
930771176 2:55132096-55132118 AAGTAGAAGCTGGAGGAAATCGG + Intergenic
931601908 2:64012750-64012772 AAGTAGTAGCTGGAGGAGGCAGG - Intronic
931700008 2:64901818-64901840 GAGAAGTAGATGGAGGAAGACGG + Intergenic
931848581 2:66230403-66230425 AAGAAGTAGCTGCTTGGAGGGGG + Intergenic
932993990 2:76826274-76826296 AAGAAGTAGCTTAATAGAGTAGG + Intronic
935685412 2:105678549-105678571 AGGAGGTACCTGGCTGAAGTGGG - Intergenic
935700897 2:105811021-105811043 AAAAAGTAGCTGGGTGTGGTGGG + Intronic
937357289 2:121206004-121206026 AAGAAGAATCTGGAGGAGGTGGG + Intergenic
937795553 2:126014414-126014436 AAGAAGTAGCTGCAGTAAGAGGG + Intergenic
938485718 2:131705720-131705742 CTGAAGCAGCTGGAAGAAGTGGG - Intergenic
939037923 2:137155335-137155357 AAGAGGCAGCTGGAGGAAGTGGG + Intronic
939159301 2:138567457-138567479 GAGAAGAAGCTGGAGAAAGTAGG + Intronic
939511035 2:143104960-143104982 AAGTAGTTGCTGAATGAATTAGG + Intronic
939811782 2:146841805-146841827 AAAAATTAGCTGGATGTGGTGGG - Intergenic
940485727 2:154292772-154292794 AACAAGCAGCTGCATGAATTTGG + Intronic
945007169 2:205420987-205421009 AAAAATTAGCTGGATGTGGTGGG + Intronic
945155417 2:206832612-206832634 AAGGAGTAGGAGGATGAATTTGG - Intergenic
945381275 2:209144540-209144562 ATAAAGCAGCTGGAAGAAGTAGG + Intergenic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
946566394 2:220970393-220970415 AAAAATTAGCTGGGTGTAGTGGG + Intergenic
947341385 2:229143507-229143529 AACCATTAACTGGATGAAGTGGG + Intronic
947727069 2:232407499-232407521 AATAAGGAGCTGGAGGCAGTTGG + Intronic
947941575 2:234060654-234060676 AAGAATAAGCTGGGAGAAGTAGG - Intronic
1169088823 20:2844735-2844757 TAGATGTAGGTGCATGAAGTGGG + Intronic
1169094529 20:2884959-2884981 AAAAATTAGCTGGATGTGGTGGG - Intronic
1169794721 20:9449374-9449396 AGGAAGTAGCTGAGGGAAGTTGG + Intronic
1169888495 20:10428686-10428708 AAAAATTAGCTGGATGTGGTGGG + Intronic
1170107438 20:12766876-12766898 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1170595184 20:17799982-17800004 AAGCAGTAGCCAAATGAAGTGGG + Intergenic
1170886616 20:20345109-20345131 AAGAAGTGGGTGGATAAAGTGGG + Intronic
1173874526 20:46361897-46361919 AAGCAGGAGCTGCAAGAAGTTGG - Intronic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1174300005 20:49574858-49574880 AAAAATTAGCTGGGTGTAGTAGG + Intergenic
1175769340 20:61613670-61613692 AAGAAGCAGAGGGATGATGTGGG + Intronic
1177155765 21:17499886-17499908 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1180945471 22:19690098-19690120 AAAAATTAGCTGGATGCTGTGGG - Intergenic
1181144583 22:20835578-20835600 AAGTATTAGCTGGGTGCAGTGGG + Intronic
1181275273 22:21684054-21684076 AAAAATTAGCTGGGTGTAGTTGG + Intronic
1181438795 22:22925187-22925209 GGGAGGAAGCTGGATGAAGTGGG - Intergenic
1183334300 22:37237852-37237874 AAGGAGCAGCAAGATGAAGTCGG + Intronic
1183422662 22:37721163-37721185 AAAAATTAGCTGGATGCAGCCGG - Intronic
1184184990 22:42858335-42858357 AGGAAGCAGCTGGCTGAACTGGG - Intronic
1184614746 22:45630472-45630494 AGGAAGCAGGGGGATGAAGTGGG + Intergenic
949402302 3:3678651-3678673 AATAATTAGCTGGCAGAAGTTGG + Intergenic
949554295 3:5139793-5139815 AAGTAGTTACTGGATGATGTTGG + Intronic
949694600 3:6680138-6680160 AAGCAGTAAGTGGATGAACTGGG + Intergenic
950312332 3:11969420-11969442 AAAAATTAGCTGGATGTGGTGGG + Intergenic
950336629 3:12199727-12199749 AAGAACTAGCTGGGTGCACTGGG + Intergenic
950358223 3:12429572-12429594 AAGAAGCAGGTGGAGGAAGGAGG + Intronic
951170095 3:19531728-19531750 ATTAAGTTGCTGGATGAATTAGG + Intronic
951186439 3:19719306-19719328 AAGAACTGGGTGGATGAAGATGG - Intergenic
951209126 3:19955378-19955400 CAGAAGTAGCTGCATTAACTAGG + Intronic
951925132 3:27901193-27901215 GAGAAGTAGTGAGATGAAGTAGG - Intergenic
952559460 3:34573799-34573821 AAGAAGAAGAAGGAGGAAGTAGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953208754 3:40855550-40855572 AACAAGGAGCTGCAAGAAGTGGG - Intergenic
955715556 3:61825795-61825817 AAAAAGTAGCTGGATGTGGTAGG - Intronic
956032428 3:65053258-65053280 AAGAAGTGTCTGGATGAAGCTGG + Intergenic
957117551 3:76046076-76046098 AAGCAGGAGCTGGATAAAGATGG - Intronic
957269362 3:78009355-78009377 AAGAAGTAGGTGGATTGATTTGG + Intergenic
957562967 3:81847456-81847478 AAGAAGCAGCTGGTTAAAATGGG + Intergenic
958129234 3:89396185-89396207 CATAAGTAACTGGATTAAGTTGG - Intronic
960712646 3:120546315-120546337 AAGAGGTAGCTGGATCATGAGGG - Intergenic
960728631 3:120698714-120698736 AACAAGTAGATGGAAGAAGTTGG - Intronic
961410235 3:126715105-126715127 AAGCAGTCGGTGGAGGAAGTGGG + Intronic
961753279 3:129110298-129110320 AAGAGGTAGCTGGATAAATGGGG + Intronic
962493454 3:135916338-135916360 GAGAAGTAGCAGTTTGAAGTAGG - Intergenic
962838148 3:139206759-139206781 AAAAACTATATGGATGAAGTTGG - Intronic
962935870 3:140080368-140080390 AAGAAGTGACTGGACGTAGTAGG + Intronic
963209622 3:142674664-142674686 GAGAAGTTGTTGGATGAAGATGG + Intronic
963227502 3:142877238-142877260 AGGCAGTGGCTGGTTGAAGTAGG + Intronic
963793365 3:149606663-149606685 GACAAGAAGCTGGATGAAGGCGG - Intronic
964351689 3:155809512-155809534 TAGAAGTGGATGGCTGAAGTGGG - Intergenic
964724211 3:159797399-159797421 AATAAGAAACTGCATGAAGTTGG - Intronic
964869134 3:161293699-161293721 AAGAAGGAGGAGGATTAAGTAGG + Intergenic
965574642 3:170205808-170205830 AAAAATTAGCTGGATGTGGTGGG - Intergenic
965657771 3:171007102-171007124 ATGAAGTAGATGGGTGCAGTAGG + Intronic
965778921 3:172262744-172262766 AAAAATTAGCTGGATGTGGTGGG + Intronic
966037076 3:175431998-175432020 AAGTAATAGCTGCATGAATTAGG - Intronic
966535424 3:181027873-181027895 AAAAATTAGCTGGGTGCAGTGGG + Intergenic
966780181 3:183577707-183577729 AAGAAGAAGAGAGATGAAGTTGG + Intergenic
966883005 3:184360498-184360520 AGAAAGTAGCTGGATGAATCAGG - Intronic
967033053 3:185626405-185626427 AACAAGTAAATGGATGAAGAGGG - Intronic
968211737 3:196854681-196854703 AAAAATTAGCTGGATGTGGTTGG - Intergenic
968347090 3:198017763-198017785 AAAAATTAGCTGGGTGTAGTGGG + Intronic
968669521 4:1841528-1841550 AACAAGAAGCTGGAGGAAGGCGG - Exonic
969383768 4:6828220-6828242 AAAAATTATCTGGATGCAGTGGG + Intronic
970913267 4:21304231-21304253 AAGTAGCAGCCGGATAAAGTCGG + Intronic
971746770 4:30590391-30590413 AAGAACTAGCTCTATGAAGATGG + Intergenic
972079626 4:35135080-35135102 ATAAGGTAGCTCGATGAAGTAGG + Intergenic
972607858 4:40630378-40630400 AACAAGTCGCTGGACGAGGTGGG + Intronic
973053049 4:45618313-45618335 AAGAAGAAGATAGATAAAGTAGG - Intergenic
973765828 4:54161585-54161607 ACGAAGCAGCTGGATGACATTGG - Intronic
974449490 4:62034189-62034211 AAAAGGCAGCTGGATGAATTTGG - Intronic
975857521 4:78640573-78640595 AAAAATTAGCTGGATGTAGTGGG - Intergenic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
976758657 4:88524575-88524597 AATTAGTAGCTGGATGACTTTGG + Intronic
976887411 4:90002654-90002676 AAGCAATAGCTGGATGAAGGCGG + Intergenic
977803713 4:101271029-101271051 ATGAAGTGGCTGGCTGAGGTGGG - Intronic
977894869 4:102352200-102352222 AAGAAGTAAATGTAAGAAGTAGG + Intronic
977984289 4:103363568-103363590 AAGAAGTAGCAGGGGGAAGGGGG - Intergenic
978436485 4:108690708-108690730 CAGAAGTGGCTGGCTAAAGTTGG - Intergenic
979343335 4:119555041-119555063 AAGAAGCAGCTGGGTCAGGTTGG - Intronic
979343794 4:119560966-119560988 AAAAATTAGCTGGATGTTGTGGG + Intronic
980300891 4:130992138-130992160 CAGAAATAGCTGGTTGTAGTCGG + Intergenic
980788268 4:137582629-137582651 ATGAAGAAGCTGGAAGAAATGGG + Intergenic
981057754 4:140383266-140383288 AATCACTAGCTGGATGAAGAGGG - Exonic
981805419 4:148709745-148709767 AAAAAATAGCTGGATATAGTGGG - Intergenic
981862711 4:149377439-149377461 AAGAAGTAGCTCAATAAGGTAGG - Intergenic
981968358 4:150634130-150634152 AGGAGGTAGCTAGATGAAGACGG - Intronic
983872771 4:172841408-172841430 AAATAGTAGCTGCATGAACTTGG - Intronic
984070199 4:175101714-175101736 AAAAATTAGCTGGATGTGGTGGG + Intergenic
984562307 4:181284883-181284905 AAAAAGTAGTTGGGGGAAGTGGG + Intergenic
985336245 4:188898571-188898593 ACGAAGTGGCTGGATGCTGTAGG - Intergenic
986242343 5:5972425-5972447 AATAAGTAGCTGGGTGTGGTGGG - Intergenic
987386890 5:17338476-17338498 AAGAAGTATCTGGATGGATACGG - Intergenic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
989306259 5:39960126-39960148 AAGTGGAAGCTGGAAGAAGTGGG + Intergenic
989464685 5:41741100-41741122 AAAAATTAGCTGGATGTGGTGGG - Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992790182 5:80206494-80206516 AAGAAGAATCTGGAGGAAGCTGG - Intronic
992948075 5:81829217-81829239 AAAAAGCAGGTGGATGAAGGTGG + Intergenic
993581576 5:89668430-89668452 AAAAAGTTGCAGGATGAAGTAGG - Intergenic
993691577 5:91007430-91007452 AGGCAGTAGCAGGATGGAGTAGG - Intronic
993737916 5:91499656-91499678 AAAAATTAGCTGGATGTGGTGGG - Intergenic
993887580 5:93434245-93434267 TAGAAGAAAATGGATGAAGTGGG + Intergenic
995476205 5:112551036-112551058 AAAAAGTGGCTGGATGAGGGTGG - Intergenic
995477019 5:112558559-112558581 AAAAATTAGCTGGATGTGGTGGG - Intergenic
995985550 5:118166704-118166726 AAAACGTGGCTGAATGAAGTTGG + Intergenic
996148657 5:120007986-120008008 AATAAGAATCTGGATGGAGTGGG - Intergenic
996750415 5:126883001-126883023 AGGAAGTAGCTGGATGGAAGGGG + Intronic
997715034 5:136036207-136036229 AAGAAATGTCTGGATGAGGTGGG + Intronic
999265737 5:150265643-150265665 AAGAAATAACTGAATGAAGCTGG + Intronic
1001380887 5:171305734-171305756 AAGAAGAAGCTGGAAGAAAGGGG - Intergenic
1001978196 5:176018172-176018194 AAAAATTAGCTGGATGTGGTGGG - Intronic
1002067266 5:176658080-176658102 AAGAAGTAGCTGGAAGCCATGGG + Exonic
1002239223 5:177825590-177825612 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1002639385 5:180623515-180623537 AGGAAGTGACTGGAGGAAGTAGG + Intronic
1002978808 6:2113312-2113334 AGGAAGTTGCTGGATGAGGATGG - Intronic
1004381913 6:15139800-15139822 CTGAAGTAGGTGGATGAAGTAGG - Intergenic
1005429237 6:25736927-25736949 AAGATCTAGCAAGATGAAGTTGG - Intergenic
1006027401 6:31156205-31156227 AAGAAGCAGCATGATGAAGAAGG - Intronic
1007722727 6:43894874-43894896 AAGAAGTAGGTGGCCAAAGTAGG - Intergenic
1009502154 6:64427800-64427822 AAGAAGTAACACAATGAAGTAGG + Intronic
1010088968 6:71956622-71956644 AAGAAATAGCTGTATGAAGTCGG - Intronic
1010417950 6:75636709-75636731 AAGAAGAAACTGCATGCAGTAGG + Intronic
1011758386 6:90529494-90529516 AAGTAGTAGCAGTAAGAAGTTGG + Intronic
1012268336 6:97174714-97174736 CGGAAGTGGGTGGATGAAGTAGG + Intronic
1013018245 6:106181020-106181042 AATAATTAGCTGGATGTAGGGGG + Intergenic
1013941947 6:115675052-115675074 AAGAATTAGCTGGGTGTGGTGGG - Intergenic
1014083653 6:117316650-117316672 AGGAAGTAGATGGGTGGAGTAGG + Intronic
1014560388 6:122882964-122882986 AAGAAGTTGCTTTATGAAGCTGG + Intergenic
1015845534 6:137516485-137516507 AAGAAGTAGCTGGATGATTGAGG - Intergenic
1015956730 6:138606664-138606686 AAGAAGTAGCCAGATGAAGGTGG - Intronic
1017422003 6:154282384-154282406 AAGAAGTAGATGGATCAGGCAGG + Intronic
1017447039 6:154516569-154516591 AAGAAGGTGCTTTATGAAGTGGG - Intergenic
1017710772 6:157165694-157165716 AAAAATTAGCTGGATGCTGTTGG + Intronic
1018262911 6:161988334-161988356 AAAAATTAGCTGGGTGTAGTGGG + Intronic
1018524909 6:164699127-164699149 ATGAAGTTGCTGGTTGAAATTGG - Intergenic
1019066867 6:169309669-169309691 AAAAATTAGCTGGACGTAGTGGG + Intergenic
1020020277 7:4862210-4862232 AAGAATTAGATGGGTAAAGTTGG - Intronic
1020804160 7:12767480-12767502 AAGAAGTAGCCAGATGATGATGG + Intergenic
1020890816 7:13875965-13875987 AAGAGATAGCTGGATGAAGATGG + Intergenic
1021357628 7:19671728-19671750 AAGATACACCTGGATGAAGTGGG + Intergenic
1021604785 7:22398929-22398951 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1021891006 7:25186331-25186353 AGGGAGTAGCTGGAGGAATTTGG - Intergenic
1022153391 7:27633505-27633527 AAAAATTAGCTGGGTGTAGTGGG + Intronic
1022921424 7:35019480-35019502 AAGAAGTAGGAGGAAGAAGAAGG + Intronic
1023272093 7:38474705-38474727 AAGAAGTTGTTGGATGAAATAGG - Intronic
1024333027 7:48175844-48175866 AAGAAGTAGCTGGTGAAGGTAGG - Intronic
1025946949 7:66111989-66112011 AAAAAGTAGCTGGGTGTGGTGGG - Intronic
1028056484 7:86251790-86251812 AAGAAGTACTTTGAGGAAGTGGG + Intergenic
1028217945 7:88158239-88158261 AAGAACTTGCTTGATGAAGCTGG - Intronic
1029081789 7:97980490-97980512 AAAAATTAGCTGGGTGCAGTTGG + Intergenic
1029102322 7:98142166-98142188 AAGAAGTAGGTTCAAGAAGTAGG + Intronic
1029145121 7:98440238-98440260 AAGAGGTTGCTGCATGGAGTTGG - Intergenic
1029941128 7:104481848-104481870 AAGAAGTAGGTGACTGAAGTAGG + Intronic
1030447053 7:109659276-109659298 AAGAGGAATCTGGATCAAGTAGG + Intergenic
1030691944 7:112545104-112545126 AAGAACTAGCTTTATGAAGCTGG + Intergenic
1030742371 7:113125184-113125206 TAGATATAGCTGGATAAAGTGGG + Intergenic
1031964675 7:128019094-128019116 AGGAACTAGCTGGCTGAGGTGGG - Intronic
1032321406 7:130889444-130889466 AAAAATTAGCTGGGTGTAGTGGG - Intergenic
1033658869 7:143390494-143390516 AAGATGGAGCTGGATGGGGTGGG + Intronic
1036138469 8:6183541-6183563 AAAAATTAGCTGGACGTAGTGGG - Intergenic
1038885054 8:31654204-31654226 AGGAAGTAGGTGGATGATATTGG - Intronic
1039174853 8:34792355-34792377 AAAAAGTAGCTGGCTGCAGTGGG + Intergenic
1039501597 8:38022025-38022047 AAAAAATAGCTGGGTGTAGTGGG - Intergenic
1039811767 8:41055262-41055284 AAGAAAGAGCGGGATGAAATGGG + Intergenic
1041509038 8:58633907-58633929 AAAAAGTAGGTGGAGGAATTTGG + Intronic
1041662091 8:60410694-60410716 AAAAATTAGCTGGATGTGGTGGG - Intergenic
1041753061 8:61282335-61282357 AAGAAGCAGCTGGTAGAAGCAGG + Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1043006245 8:74822411-74822433 AGGAAGTGGCTGGATGGAGGAGG - Intronic
1043369247 8:79571937-79571959 AAGAAATGGCTGGATGAGGACGG - Intergenic
1043816011 8:84802442-84802464 TGGAAGGAGCTGGTTGAAGTGGG + Intronic
1043817735 8:84823754-84823776 AAGAAGTAGAGGGAAGAAGTAGG - Intronic
1044108248 8:88238504-88238526 AAAAATTAGCTGGATGCAGCTGG + Intronic
1045655003 8:104377520-104377542 AAAAATTAGCTGGATGTGGTAGG + Intronic
1047106526 8:121737146-121737168 AAGAAGCAGAAGGATGAATTTGG - Intergenic
1047886815 8:129260403-129260425 AAGCTGGAGCTGGCTGAAGTTGG + Intergenic
1048626051 8:136186579-136186601 AAAAATTAGCTGGATGTGGTTGG + Intergenic
1051146579 9:14033433-14033455 GAGAAGTAGCTGGGAGAAGGTGG + Intergenic
1051163070 9:14230645-14230667 AAAAATTAGCTGGAGGAAATGGG + Intronic
1051260985 9:15264500-15264522 AAAAATTAGCTGGACGTAGTTGG + Intronic
1051700507 9:19817883-19817905 TAAAATTAGCTGGATGTAGTAGG - Intergenic
1052713882 9:32091403-32091425 AAGAGGAAGATGGAAGAAGTGGG - Intergenic
1052783549 9:32806187-32806209 AAAAAATAGCTGGATGTGGTGGG - Intergenic
1052903088 9:33811586-33811608 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1054778494 9:69144506-69144528 AAAAAATAGCTTGAAGAAGTTGG + Intronic
1055621870 9:78134381-78134403 AAGATGCAGATGGATGAAGGAGG - Intergenic
1056192436 9:84197509-84197531 AATAAGTATCTGGATGACCTAGG + Intergenic
1056390466 9:86136730-86136752 AAAAATTAGCTGGATGTGGTGGG - Intergenic
1060736779 9:126071180-126071202 AAGAGGTAGCTGGAAGGAGCTGG - Intergenic
1061468057 9:130798817-130798839 AAGAATTAGCTGGGTGTGGTGGG + Intronic
1185743441 X:2552371-2552393 AAAAATTAGCTGGATGTGGTAGG + Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1186042373 X:5495094-5495116 GGGAAGTAGCTGTATAAAGTAGG - Intergenic
1186191122 X:7068592-7068614 AAGAAGTGGATGGATAAAGGAGG + Intronic
1186315829 X:8368959-8368981 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1186463567 X:9766743-9766765 AAAAATTAGCTGGATGTGGTGGG + Intronic
1187407121 X:19014255-19014277 AGGAAGTAGGTGGTAGAAGTGGG - Intronic
1188046412 X:25430253-25430275 AACAACTAGCTGAATGAAGTTGG + Intergenic
1189030083 X:37441455-37441477 TAGTAGTAGCTGGCTGAAGGCGG - Intronic
1189596319 X:42570026-42570048 AAAAAGAAGCTGGAGGAAGAGGG + Intergenic
1190114588 X:47618415-47618437 AAGAAGTAGCTGGAGAACGGGGG + Intronic
1192247494 X:69385961-69385983 GAGAAATAGTTGGAAGAAGTGGG - Intergenic
1193746433 X:85288218-85288240 AGGAGGTAGTTGGATGAAGCAGG - Intronic
1194488364 X:94514982-94515004 AAGAAGTAGCTGGAGTAAGCTGG - Intergenic
1195371746 X:104182449-104182471 AAGAAGTAACTTGATGAAACTGG - Intronic
1195747447 X:108132851-108132873 ATCAAGTAGCAGGAAGAAGTTGG + Intronic
1195870774 X:109482942-109482964 AAGAAGGACATGGATGAAATTGG + Intergenic
1196028076 X:111063677-111063699 AAAAATTAGCTGGGTGCAGTGGG + Intronic
1196213707 X:113025503-113025525 AAAAAGTATCGGGATAAAGTGGG + Intergenic
1196832411 X:119786158-119786180 AAAAATTAGCTGGATGTGGTGGG + Intergenic
1198252164 X:134890244-134890266 ATGAAGTAGCTAGATAAAATTGG + Intronic
1198523305 X:137474240-137474262 AAGAAGTAGGTTGAGGAGGTAGG + Intergenic
1198528332 X:137524544-137524566 AAGAACTTTCTGGAAGAAGTGGG - Intergenic
1200766595 Y:7085350-7085372 AAAAAGTAGCTGGGTGTGGTAGG + Intronic