ID: 1117612760

View in Genome Browser
Species Human (GRCh38)
Location 14:57501671-57501693
Sequence GCATACTTCAGAAATGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117612760_1117612764 11 Left 1117612760 14:57501671-57501693 CCCATGCCATTTCTGAAGTATGC No data
Right 1117612764 14:57501705-57501727 GCAAAGCCTCGCCAATGGTTTGG No data
1117612760_1117612763 6 Left 1117612760 14:57501671-57501693 CCCATGCCATTTCTGAAGTATGC No data
Right 1117612763 14:57501700-57501722 AGTATGCAAAGCCTCGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117612760 Original CRISPR GCATACTTCAGAAATGGCAT GGG (reversed) Intergenic