ID: 1117612763

View in Genome Browser
Species Human (GRCh38)
Location 14:57501700-57501722
Sequence AGTATGCAAAGCCTCGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117612758_1117612763 27 Left 1117612758 14:57501650-57501672 CCACAAGAATACCAACTTGGACC No data
Right 1117612763 14:57501700-57501722 AGTATGCAAAGCCTCGCCAATGG No data
1117612759_1117612763 16 Left 1117612759 14:57501661-57501683 CCAACTTGGACCCATGCCATTTC No data
Right 1117612763 14:57501700-57501722 AGTATGCAAAGCCTCGCCAATGG No data
1117612761_1117612763 5 Left 1117612761 14:57501672-57501694 CCATGCCATTTCTGAAGTATGCA No data
Right 1117612763 14:57501700-57501722 AGTATGCAAAGCCTCGCCAATGG No data
1117612762_1117612763 0 Left 1117612762 14:57501677-57501699 CCATTTCTGAAGTATGCAAGTGC No data
Right 1117612763 14:57501700-57501722 AGTATGCAAAGCCTCGCCAATGG No data
1117612760_1117612763 6 Left 1117612760 14:57501671-57501693 CCCATGCCATTTCTGAAGTATGC No data
Right 1117612763 14:57501700-57501722 AGTATGCAAAGCCTCGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117612763 Original CRISPR AGTATGCAAAGCCTCGCCAA TGG Intergenic