ID: 1117612764

View in Genome Browser
Species Human (GRCh38)
Location 14:57501705-57501727
Sequence GCAAAGCCTCGCCAATGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117612761_1117612764 10 Left 1117612761 14:57501672-57501694 CCATGCCATTTCTGAAGTATGCA No data
Right 1117612764 14:57501705-57501727 GCAAAGCCTCGCCAATGGTTTGG No data
1117612759_1117612764 21 Left 1117612759 14:57501661-57501683 CCAACTTGGACCCATGCCATTTC No data
Right 1117612764 14:57501705-57501727 GCAAAGCCTCGCCAATGGTTTGG No data
1117612762_1117612764 5 Left 1117612762 14:57501677-57501699 CCATTTCTGAAGTATGCAAGTGC No data
Right 1117612764 14:57501705-57501727 GCAAAGCCTCGCCAATGGTTTGG No data
1117612760_1117612764 11 Left 1117612760 14:57501671-57501693 CCCATGCCATTTCTGAAGTATGC No data
Right 1117612764 14:57501705-57501727 GCAAAGCCTCGCCAATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117612764 Original CRISPR GCAAAGCCTCGCCAATGGTT TGG Intergenic