ID: 1117614170

View in Genome Browser
Species Human (GRCh38)
Location 14:57516238-57516260
Sequence AGTCTGAATAGACCAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117614170_1117614174 6 Left 1117614170 14:57516238-57516260 CCTGCTATTGGTCTATTCAGACT No data
Right 1117614174 14:57516267-57516289 CTTCCTGGTTTAGTCTTGGGAGG 0: 4909
1: 3354
2: 2054
3: 1804
4: 2205
1117614170_1117614171 -9 Left 1117614170 14:57516238-57516260 CCTGCTATTGGTCTATTCAGACT No data
Right 1117614171 14:57516252-57516274 ATTCAGACTCAACTTCTTCCTGG No data
1117614170_1117614172 2 Left 1117614170 14:57516238-57516260 CCTGCTATTGGTCTATTCAGACT No data
Right 1117614172 14:57516263-57516285 ACTTCTTCCTGGTTTAGTCTTGG 0: 7845
1: 4044
2: 2111
3: 1994
4: 3017
1117614170_1117614177 21 Left 1117614170 14:57516238-57516260 CCTGCTATTGGTCTATTCAGACT No data
Right 1117614177 14:57516282-57516304 TTGGGAGGGTGTATGTGTCCAGG 0: 2577
1: 4507
2: 5489
3: 3080
4: 2288
1117614170_1117614173 3 Left 1117614170 14:57516238-57516260 CCTGCTATTGGTCTATTCAGACT No data
Right 1117614173 14:57516264-57516286 CTTCTTCCTGGTTTAGTCTTGGG 0: 8208
1: 3830
2: 1865
3: 1367
4: 1454
1117614170_1117614175 7 Left 1117614170 14:57516238-57516260 CCTGCTATTGGTCTATTCAGACT No data
Right 1117614175 14:57516268-57516290 TTCCTGGTTTAGTCTTGGGAGGG 0: 4718
1: 3187
2: 1764
3: 861
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117614170 Original CRISPR AGTCTGAATAGACCAATAGC AGG (reversed) Intergenic
No off target data available for this crispr