ID: 1117615512

View in Genome Browser
Species Human (GRCh38)
Location 14:57530049-57530071
Sequence AATTGGTGGTAGGAGAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117615505_1117615512 26 Left 1117615505 14:57530000-57530022 CCAGTGATCGTCAGACTTTTGGT No data
Right 1117615512 14:57530049-57530071 AATTGGTGGTAGGAGAAGGGTGG No data
1117615506_1117615512 0 Left 1117615506 14:57530026-57530048 CCAGATCAGTAATGTATTTTTAA No data
Right 1117615512 14:57530049-57530071 AATTGGTGGTAGGAGAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117615512 Original CRISPR AATTGGTGGTAGGAGAAGGG TGG Intergenic
No off target data available for this crispr