ID: 1117616418

View in Genome Browser
Species Human (GRCh38)
Location 14:57538193-57538215
Sequence ATCTTCTTCTTTAAGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117616418_1117616422 7 Left 1117616418 14:57538193-57538215 CCCTCCTACTTAAAGAAGAAGAT No data
Right 1117616422 14:57538223-57538245 TGGTTCGTAAGAGACATCCTTGG No data
1117616418_1117616423 8 Left 1117616418 14:57538193-57538215 CCCTCCTACTTAAAGAAGAAGAT No data
Right 1117616423 14:57538224-57538246 GGTTCGTAAGAGACATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117616418 Original CRISPR ATCTTCTTCTTTAAGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr